Transcript Name :
Physo_322094
Orientation:
(+)
Number of Exons:
4
Description :
ABC transporter ABCG family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ABC transporter-like8.984PS50893
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain2.1SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
331-336
394-399
460-548
1-310
360-373
423-436
572-576
311-330
337-359
374-393
400-422
437-459
549-571
NN-scoreoddsWeighted Score
0.5024.9960.01
*** None ***
TypeScore
endoplasmic reticulum556
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        1920 bases(100 bases per row)
ATGAGCGACGAGGACGACGGTTCTGATCACTATCAGCTTGCGGCAACTCCGAAGGAAGGCAGTCGAACTACGCCATCAAAATCACCGAGTAACGCCGTAT
CGATTGATATCCAAGAACCTCTCAAAGCGTTCGTGCCAGTGACGGTGGCGTTCAAGGACCTGTGGTATTCCGTTCCCAACCCGAGCAAACCAACGGAGTC
CATCAACTTACTGAAGGGAATCAGCGGGTTCGCGCGTCCGGGGACCATCACAGCGCTCATGGGCTCCTCCGGTGCCGGCAAGACAACTCTCATGGATGTG
ATCGCCGGGCGGAAGAACACGGGCTCTATCAGGGGTAAGATTCTGCTCAACGGTCACGAGGCGACGGAGCTTGCTATCCGGCGGTGCACGGGGTACTGCG
AGCAGACGGATATTCACTCCGAGACGGCGACATTCCGCGAGGCGCTCACTTTCAGTGCCTTTCTCCGTCAGGACAGTGACATTCCAGCGAGTGCCAAGCT
CGAGTCCGTGAATGAAATCGTGAACTTGCTGGGCCTTGAGAATGTGGCGGATCACATGGCACGCGGGAGCTGAAGCGACTGACGATTGGCGTGGAGCTAG
CGGCCCAGCCGAGTGTGCTCTTTCTGGATGAACCCACGAGCGGCCTGGACGCGCGCTTCGCCAAGATGATCATGGACAGTATCTGCAAGGTCGCGAACTC
TGGGCGTACGGTTATCTGTACAATTCACCAGCCGTCGTACTAACCTGCTACTGCTCAAATGTGGCGGTGAGACGGTATACTTCGGCGAGCTCAGGACTGT
CAGACGCTGGTTGACTACTTTGAGGCGATCCCAGGTGTGCAACCGCTGCCTGAAAAGTACAACCCTGCAACCTGGATGCTCGAATGCATCGGCGCTGGTG
TCAACAATCCGGTTTCTGAAGGAGATGACAAGGATTTCGTGCAGCGATTTAACGAGAGCGTACTCAAATCGCAGCTGGATGTGGTTTTGGAGGAGGACGG
CGTTGGACGTTCGTCTCCTGATGCCCCACCTTTGATATCATCGTAAGCGAGCAGCTTCTACGGTGGTGCAGTTGAAATTCCTGCTTCAGCGGTTTTTCAT
CATGTACTGGCGGTCTCCGGCGCACAGCCTCACACTGCTGGGTGTAGCACTTGGAAGTATCATCGTGCTGGGACTTGTCGGTATGGATTTATCCACGACT
TCGTATCAGGGGGTGGCCTCGGGCCTCGGCATCATTTTCGTCGCGTTCCAGTTCCAAGGGTTCGTGTCCTTCAATAGCTCAATTCCGTTCGCTTTCAACG
ACTGCGCAGCTTTCTACCTGTCTTACTTTGCTGCTGGGACGGTCGTGGAAATCCCGTATGTCTTCGCGAAGGGGTTGATCATTTCGGCGCTCCTGTTCCT
CTTCATGAGCTTCACCGGATTCGTCAAGTTCCTTTTGTTCTGGCTGGCCACGTCCCTCTCGATTCTTGTGGACGTCTACGCGGGCCACCTGCTCGCGTTC
GTGCTGCCAAACATCGTCATGGCGTCACTTGCCGGGTCCGTCGTGTCCACGGTCTTCTTCCTCTTCGTCGGGTTCAATCCGCAGGGCAGCTCCATCTCCG
CCGGCTACCAGTGGCTCTACACGATCACCCCGCAGCGCTACGCCATGCCGATCCTCGCTACGTTGACGCATGGCGACTGCTCCACGACCCCGGAGCTCAA
CGCCGTCACGGGTGACTACATCGATGTTGGCCCGGAGATCAGATGCCAGCCGCTGCAAGACGCCCCACTCGCAGTCGGCAACGTGACGGTCAAGGGGCTG
CTCGAAGACGCGTACAACATGAAGCACGACGACATCGGCCGCTACTTTGGAGCGCTCCTGGTCTTCGCCGTAGTCTTTCGCGTTCTCGCGCTGCAGTTCC
TCAACCACCAGAAGCGGTAG