Transcript Name :
Physo_468404
Orientation:
(+)
Number of Exons:
1
Description :
glycoside hydrolase family 17-like protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.8380.86821
InsideOutsideTMhelix
1-294
NN-scoreoddsWeighted Score
0.7147.3110.015
*** None ***
TypeScore
vacuolar222
GO
*** None ***
*** None ***
*** None ***
Sequence
        885 bases(100 bases per row)
ATGAAGTTCTTCGCTCCGATCTTCGCTGCCGTCGCAATGCTCGCAGCTCAAGTGAGCGCCAACGGCGTCTGCTACGACCCGAACCACGCCGCGAGCGGCG
CCATGGACGCCAGCAGCGTCAACCAAGACATAAAGACCCTAAAGAGCCAGGGCTTCACCGCAGTCCGCACGTACATCTCTAAGTTCGGCAACACGAACCT
GGGCCAGACCATTGCAACACACAACATCACGGTCGCTCTGGGCGTGCCGTACCCTCAGTCCGACTACGTTGAGCAGAAGGACGCTGCTCTCACGGCCGCG
CTCAGCGGTGGCGTGGGCTACATCTTTGTCGGGAATGAGAACCTCGCAGGCGCAAAAGCTGTGCCCAGCGACATGATCGGCCTCATCAAGAGCATCAAGT
CGCTGGTACCAGCCACGGTCAAGGTCGGCACGGTGCAGCGCAACACCGAGGTCATCAACTACGCCGGCATTGCCGGCTGGTCGGAGCTTGTAGCGGCTTG
CGACGTGCTGGGCGTGAACGTTCAGCCGTACTTCAATCCGCAGACCACTGCGGACAACGCCATCAACGTGCTCGACAACCAGTGGAAGGCCATGGAGGCG
AACTTTGCCGGCAAGTTGATGCTGACGGAGACTGGATGGCCCTCGGAAGGAACGCTCTCGGGTAACGTCGGCAGCGCGGATGGCTTGAAGACGTTCTACA
GCGACTACAAGGAGTGGAGCAAGTCCAAGAGCGAGTCGTTCTTCTTCCAGGCGTTCGACACGCCATACAAGACCAGCGCGTTCGAGAAGTCGTTCGGCCT
GCTCACATCGGATTCCGTGGCCAAGTTCGGCATTGCCGCCGCGGCAAACGCTGCAGGGACGGTGAGCGCCCAAGTGCAGAATTAA