Transcript Name :
Physo_473059
Orientation:
(-)
Number of Exons:
2
Description :
p300/CBP acetyltransferase-related protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-226
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        759 bases(100 bases per row)
ATGTTCTACCTGCAGAGCCTCTCTACGAACGGCGGGACTGATCGAGGTGCCTTTGGTTCGGTGGCCGCGCTCTCCGCGCACCCATTCCCGTTGCTGCCGC
GTGATCGACCGCCGCCGCCGTCCTACTCCATCTCGCGCTCGCAGATCGTCGCTAGCTCTCCCGACGTCCATGGACTCTCGCGCAAGCGCAGCCACAGCGG
CGAGTCGCTCTCGGCGCAGTCCGCCGGCACGCCGCCTCGCATCTCGTTCGCAGCGCCGCTTGTGTCGTTCGCTCCTCCGGCGTCGTTGGGAGGGACGTCC
AGTGCCGTTCCGACTGCTTCAGGCCGACCAGCGGCAGTGTCGTCGTCGTCGTCGCCGTCTTTCAGGTGCCAGGTGCCAGTGCCGCCAAGCGCCAAGCGTC
TGCGCCGCGAACCTCTGAGCCCCACGTCAGTAGGAGACGTCTCCGACACGAGGAAGTTGCCTCCTGCCAAGACAGCTGTAGCTGCGACTCCCGGAACTGC
GCAGATGCAGTCGATGCTACGCGGATTGCAGCATCTATCGACCTGCGGCGCCAATGGCTGCTCAAACCCATTGTGTGTGTCCACGCGGGCTTTTGTAGAC
AAAGTGAAAGTTCATCGAGCGAGCATGGCGGGCAAAGCGACGCATGACGAGAACAAGTGCGGCGCGTGCAAGCTCTGGGGGGCCATCGTGAAGGCGCACG
CCCCCACATGCTGCGCTGGTGCTACGTGCCGCGTGCCTGGGTGCTCGCCGCAAGAGTGA