Transcript Name :
Physo_477971
Orientation:
(+)
Number of Exons:
4
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-11
35-116
12-34
NN-scoreoddsWeighted Score
0.6841.2990.003
*** None ***
TypeScore
nuclear304
GO
*** None ***
*** None ***
*** None ***
Sequence
        534 bases(100 bases per row)
TCCAGCTTCTCCTTAGTCATACCTCGCATGCTTTTGATGTGGCGTTTGATTCTAGTCTCCCACAGCCCCTCGATGGTATTGGTGTGTGTGCCGGTGATGG
GGTCGACGAAGTTGAGGTTGTGGTTTACCCAACTGTGGGTATAGTGCATACTCAGCAGTAGGCGGTTGTTCTCTAGAGTGTGCTGCTTGTTGCCACGTTC
ACAGACATACGTGGCAAACATGTCGGACATGATCTTGGTTCTAGATTTAACATCGTACAAATACGTTAGTTGCATGTAAAAACGTGATAGAAATAAAAAA
CTTACCGAGGCTTGATAATTTTTTTGATGATGGGAGCAGGGTTTCCTTGGTACGCTTGTCGTGCACGATGCGCCCGAACCAGCGTCCAGTTGAGCGCTCA
ACGCCGCCAAATAGCCTGAACCCTTGATAGTAACGACCACGGTTGTATTCACGCTTCTTAGCGAGGCTGGTCTCATCGATCTCGACGAGATGTCCTTCGC
CTCCAATCTGTTGAGCAACAAACCGCAACATTAG