Transcript Name :
Physo_473205
Orientation:
(-)
Number of Exons:
3
Description :
PREDICTED: zinc finger FYVE domain-containing protein 16
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, FYVE-related10.162PS50178
HmmSmart predictionP-Valprediction_id
FYVE zinc finger3.9SM00064
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, FYVE-relatedIPR017455
*** None ***
InsideOutsideTMhelix
1-578
NN-scoreoddsWeighted Score
0.5682.1740.004
*** None ***
TypeScore
nuclear609
GO
Biological ProcessGO IDPrediction Method
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        1893 bases(100 bases per row)
ATGAGCTCGAGCAACGACAAGTTCCCGCTGCCCGACGGCTACTTCCCGCCGGTGAAGCTCATCCCGGCGGAGATCGAGGTCTACGAGCAGCGCGTCGAGA
TCATCATGAAGAACGCGCTGGCCGAGTACAACCTGCACGAGGCCATGGGCGCTCGGCCGGACTACGGCTCCCGGTGGAGCGTGGTCGGCAACGTCGAGCA
CCTCACGGCCATCCGCGAGGTGGACCCGTCCAGGGCGGTCGAGTCCTCGCGCGTCTTCGGACGCGTCGACGGGGACTACCGCAACTTCATCGACTTCTAC
TACTCCACCACGGCGCAGGAGGTGTTCGCCGTCAACCAGTTCATGTTCGGATACGCGGTGGATGCCGCCGTGCTGTGCAACATCCACACGAAAGAATCGG
CCAAGCCGCATCTGTATCTCGGCATGAAGTGGGTCTGCCTGGACCCGTCGACGCTGTCGCGCAAGCGCGATATGTGCTTCCTTGAGTACCTCGTCTTCAC
GAAGGACCTCCAGGAGCGCGACGTCGGCGTGCGGATCACGCTGCCGCTGCAGCTCGACGAGTGCCCGCCGCTGCCCGAGAAGCTCAAGACCAGGCGGATC
CAGTCGCACACGGTCACCATTGTCCGCCCGACCACCGACAGCGCAGACACCACGCAGATCTTCATGACGAGCGAGGTCGACATGTTCAAGGGCTCCGGGT
TCTCGTCGGTTGCTACGTTCAAGAAGCTCATGACGACGCTGAGCTCCATGGCGCTGTACGCCGACTCGAAGAAGATCTCGACCTACGGCATCCTGGACCG
CAGCAGTTGGGCGCCGAAGAAGGCGCGGTCGAACTGCTCCGTGTGCAACCGCAAGTTCTCCACGACGCGCCGCCGCCAGCACTGTCGGCTCTGTGGCGAG
GTCGCGTGTCGGCGCTGTATGACAGTCCGCGATGCGCCAAACCTCGATGACAACGCGACCTCCACGCCGCGCACGTTCCAGGTGGTGAAGACCACGTTCT
GCAAGGCTTGCATGGGCAAGATCCGCGGCAGCGACGTCACCAACAGCATTGCCGGGATTGACAGCCAGGACGAAGGATTCTCCGACGCCGAGTCGATCAG
TTGGTTCCCGGACAGGTCCCAGCGCCGAAGCTTGGACAACGATACCAACTTCACGTTGACCGGGGGCTCGGCAACTGTATCGCTCTCGCCCGTTGGAGCG
AACGCTGCTCCTGCTCTCACTATTCAAGATATCATTGTTGAGAACGCTGAGGATGAAGGCGACTACACTGTTCAAAGGAAGCAGGACAAGTTTTCCAGCA
GCATCAGCTCCGAGGTGTACTCGGAAACGAAAACGAGCGTGTCGTCCTCGCAAGATGAAGACGAAGAGATCGAGGTTGAGGTTGAGGAAGTCACGGAGCC
TGCTGCTCCGATGATGATTGATCTGCGTCATCTCCGCACTATGGCTGGTGCAGAGCGCGTCGTACAAGAAGCCGAAGAAGCTGAACTGCGGACGATGCGT
GAGTCTCTCGCAGCGCTGGACTTCAAGACGGTTCGTCTCATGAACTCGCCGTCGAACCAAGTGGACGACAATGCTGGCGATGAAGGGTTTTCGAGCAACA
GGAGCGGTAAACTACCGCCCATGGAGGAAGACGACGACGACGACGACGACGACGATGTCATTGAAGTAATCGACACGCCGAACCAGATCGTGTCTACTTC
ACGGCAAATCGTGTCGTCTCCTTTGGACGAATCGCCCATGGATGAACACGCCCTGGCAGACCAGGTGCTGTTTGGATCGAGTCGGTCAATCGACCAGTGC
CTCCAGGAGCAGGAAGTACTGCTCAAGCGCTTGGTGATGGCAGCGAACTCGTCCTCCGGATATTATCCACCCACCGCGCGCAGCCAGAAGTGA