Transcript Name :
Physo_470194
Orientation:
(+)
Number of Exons:
2
Description :
3-oxo-5-alpha-steroid 4-dehydrogenase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal30.46PS50244
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-182
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
cytoplasmGO:0005737IEA
lipid metabolic processGO:0006629IEA
*** None ***
*** None ***
Sequence
        612 bases(100 bases per row)
ATGGAGAGCCCCTCGGCCGTTTGGTTTGCCGTCGTGTACTTGTGGGGTGAGCACCGCTCGGAGACTACCCCCCTCATCGCAGCAAGCTTGTGGGGATGCC
ACTACGTCTACCGCTCCTACATCTACCCATTCCTGATTCGTACCAGCAAGGACAAACGCATGCCGCTGACCGTGATGCTTTCCGGGGACTTCTACAATGT
GATCAACGCGTACATCAACGCTCGGTACCTGAGCCAGTATGGCGACTACAGCGGGGATAGCCCGTTTGCACGGCCTTCGTTCTACGCTGGAGTCGCTCTC
TTCGTGTTTGGTCTGTCGATGAACATCTACTCGGACCAAGTGCTGATCAATCTGCGCAAACCTGGCGAGTCGGGCTACAAGATTCCCTACGGTGGACTGT
TCGAGTACGTGTCGTCGCCCAACTACCTGAGCGAGTTGCTGGAATGGACAGGCTGGACACTGCTGTCCCAATCGCCTGCAGGTTTGTCGTTCGCTGTGTA
CACCGCCACGAACCTCGTGCCCCGGGCCTTGAGCAACCATCGCTGGTACCAAGACAAGTTCCGCGACGAGTACCCGGTAAACCGCCGGGCGATCATCCCA
TTTCTGTGGTAG