Transcript Name :
Physo_538417
Orientation:
(-)
Number of Exons:
3
Description :
Hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.430.62323
InsideOutsideTMhelix
298-316
1-274
275-297
NN-scoreoddsWeighted Score
0.694.6840.009
*** None ***
TypeScore
endoplasmic reticulum444
GO
*** None ***
*** None ***
Cluster Id
4574
Sequence
        1191 bases(100 bases per row)
ATGATGAGGACGCTGCTGGGCGCCGCGCTGTGCGGCCTGGCGGCCGCGACGTCGGCCGTGTCGGCCTCCACCCTGTTCCCCCACGTGCCGGTCTTCCTGT
GGTCCCAGAGCTCGTACGTTTTATCCTCCTTCGCCCTGCTGCATTTGCCTGCCTCGAGCCGTGGATCTTACAGAGCTTCGCTCTTTGTTGCGCAGCATCT
TCGCTGGACCCAACGCCTACCTGAGCTCCGAGATGGATGAGTCCGCTGTGGCATCGGCTGTCGAGCGCGTGCTGACGCGAGATGCTAGCGCTGACAAGGA
GGTGCGTTTGCGTCTTGGCAACAGCATTCCCCTCTGTCCCCTCACTGATAACGCTCGTGTTGCTCCTCTCAGGGCGTGCTCAGCACCGAGCTCTCTTCGT
CCCAGCAGTCCGAGGTGATGTGTTTGTTCCTGCTGCCGTCGCTTACGTCGGAGGATGTGTCCCAACTCGCGAGATCCGCAGGACAGGAGTCCTTCGTGCA
GAACGCCGTGCAGAGCTCCAAGTCGTCGGTAGTGATCCCTCACACCACCCGCACCAAGCCTCTCCTCCCCGAGATGGCGAGTGCCCAGCCCCACATCGTG
GCCTCTCAAGACCTGGATGTGTTTATTGCGTCTAGGGAGGGCAAGGCGCTGCTCTCCAACGGCAAGACGGAGCTGCTGGTCGTGCAGCTCCCGGAGACCC
TGCCGCTGCCCGACGTGGATGCCGCGATCCAGGCGGCTTCAAGCAGCCTCAACGCCGCCACCGGGGGTAAGACAGACTTTGGTCTTACTGGTAACGACGC
CAGCTCGCTGGACCTCCAGGACCCGCTGGCTCGTCGCCTTGCCGCGCAGACCAAGTCGAAGAAGTCGAACTCGTCTGCTGAGGCTGCGATTCTGTGCGAA
GCGGGCTACCTCGTCGGGTACAGTGCGGCGGGCAAGGCCTTCTGCTTCTCGCACTACGTGAACATCACGCCCGACATCATGGCGGGCCTCCTCTTCGGGC
TGCTGTTCATTTTTATGGCGTACATCGGTCTGGGCGTGCTCCACCAGATCCAGACGCCGCAGAGGTACCCGTCGCACGGAGCTCCGCGCGGCAAGGAGTT
CTAGGCGCGTTGGCTGTGGACTTGAAAGTGAGCAGCATAGCCAGCAGAAGCGAAGGCAGGATGCATGCAAAATGAAAGTTTTATATTCCCC