Transcript Name :
Physo_471663
Orientation:
(+)
Number of Exons:
5
Description :
unknown
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA recognition motif domain17.08PS50102
HmmSmart predictionP-Valprediction_id
RNA recognition motif domain6.6SM00360
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-209
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
*** None ***
Cluster Id
4573
Sequence
        934 bases(100 bases per row)
ATGGACGTCGACCTGGATGACGCCCCCGACAGCGGCAACAACCGCGGCGGCAAGAAGCGCTCCGTGGTCGTCAAGAAGCCCAGCAAGGGCGGCAAGAAAG
GTGCGCCGTATCTCTCCGTTCGGTCGGTGGCGGGAGCAAGGCTTTACTGACGCGTCAATTGATGAATGTCCCCAATGAACTACCTACGTCCAGGTGGCTC
GTCCTCCATCCTGTCGCGTCTCGGTGGTAAGGACGCGGCCAGCCCCGGCACGAAGATTCTGGTGAAGAACCTCAAGTTCGACATCCTGGAGGAAGAAGTG
CGCGAGCTCTTTGGCACGGTTGGCGAGGTGTCCAAGGCTGAGATTGTGTACGACCGCTCGGGCCGATCCAAGGGCATCGCTCGCGTGTGGTTCGCCCGCC
GCTCGGACGCAGACAAGGCCATCAAGCAATACGACGGTGAGTCACTTCGGTGCATTAACCCTCTCTACTCTTTCTGATCGCGTCGCATTGGATTCCGTTG
CGTAGGACGCACACTGGACGGCCAGCCGATGCAGATTTCGCTGGACGCTGACAGGAATGTCCGCAACGGACTGTTCGGCACGGCACTTGAGCGCGACGAC
AAGGACGTGAAGTTCAAGGTTTCCTTTGGGTGAGGCACCGACCTGTGGCGTACACGTTGATCATGTTGGAGTCTGATCGTGGCTTAATACTTTGCGCAGT
GGTGGCAACAACGACAACGACCAGCAGAAGGGCCGTCGCAACAGACGCGCTCGCGGACGTGGCGAGAGGGGCAGCCAGGGGTATGTCATTACTGCTTCGT
AGCTGTCGTTGTACAAGTTGTTCTAAACATGTTTTTTATATTCGCGCTGCAGCGGCCGTGGCAAGGAGTCTGCTCCGTCCAAGACCGCCGAAGACCTGGA
CAACGAGATGGATACCTACATGAAGGACGCATAA