Transcript Name :
Physo_294522
Orientation:
(-)
Number of Exons:
2
Description :
AlNc14C540G12099
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-208
NN-scoreoddsWeighted Score
0.9265.8770.012
*** None ***
TypeScore
nuclear478
GO
*** None ***
*** None ***
*** None ***
Sequence
        666 bases(100 bases per row)
ATGGTATCACATCCACCGACCAAAAGAGCGACGACTTCTGGGAACGCGTCGCGGCCAAGTACAACGTGTTGCGACCTCGGCGTCACGAGCGCTTTCATCG
CCCCCAGAACTCTGTCGCAAAGCGCTGGCAGCTGCTACGATTGGCGGTAGGAAAGTTCTGTGGGTGTATTGCTTCCATTAGCCAGCGGCAAATCGGCTGA
GGACCGCGTCGAAGACGCCCAAGAGCTGTACGAGAAACTCTACGAAGATCACTTTGATTTTCTAGAAGCTTGGCGTGTACTTCGAGATGAAGCCAAGTGG
AAGGAGCTGCCCGATGCTAGCGGCGGGACCTCGAGCCGTAAGCGATCCAACAGCAGGTCATCAGTAACTCAGAGTGTCCGCCAGGCACCTGCAAATGAGA
GCAGAGCCGTTGGTGTAAAACGGCAAAAACAGCAGCGCACCTTGGAGGAAAGCAATGGGCGGATAGCCGATGCGGCTGTTGTCATGGCTAAATCCTCCCA
GCGCAAAGCTGAGCTGGAGGAGAAGCGTCTTGCTTTGCTAAGGGAGCGCGAGCAGAACCGTATTATCTTTGCTGCGCTGGACGGCTTAGACGAGGTCTCT
CTAAGTATCATACGCCTAAAGAAGGAGAACATTTTGCGGGAACTACAACAGGTATCTACTATTTGA