Transcript Name :
Physo_294516
Orientation:
(+)
Number of Exons:
1
Description :
hemagglutinin-neuraminidase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-119
NN-scoreoddsWeighted Score
0.9252.2920.005
*** None ***
TypeScore
nuclear652
GO
*** None ***
*** None ***
*** None ***
Sequence
        360 bases(100 bases per row)
ATGAATGCAGGACTTTGGTCCATTTTAAGCGATGCATTTGGAGGACGAGTAGGTATTAGCGGTGATGCCCTACTCGATTCTAGCGGTGATGCAGAAGAAG
AGGAAACAGACGACAAAGAATCAAAGAGGATGTGGGAGCAAAGGCCAATCCACCTCCTGTTGCGCAACTTGCCACGGCGCCGCAAGGTGGCATGGAGACA
ATCGCAGCATCGCTGGGGTCCCGTCCTACTGGGAAGACCACTTCCGCTCGCTGACTGCTGTACTGCTGCAGCATTACGAAGAGACACGTCGCTTCCAAGA
GATGCAGCTTCAATTGTTACAGGGGTTAGTGACGAAGAAGAACGAGTAGATAGCATATGA