Transcript Name :
Physo_322098
Orientation:
(+)
Number of Exons:
2
Description :
adherance factor, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, FYVE-related9.349PS50178
HmmSmart predictionP-Valprediction_id
FYVE zinc finger4.8SM00064
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, FYVE-relatedIPR017455
*** None ***
InsideOutsideTMhelix
1-660
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        2132 bases(100 bases per row)
ATGCCGCGCAGGTCGTCGCCCTCGGTGCCGCGCACGGCCTCGGTCACCTCGACCACCTCGACGTACGTAGCGATCGTCTAGCAGCTTTCTGAAGTTTGTA
ACGGCCGTCACAATTGCGGATACCTTACCTTTAGCTCATTTCGGTACTCGTCCCACGTAGCTTCCCGGCATACTAACGATTGCCTTGATGTTCCTATTGA
CTCGAATGCAGCTACCGGTCGGGCAAGCTCCAGTTTCCCCTGCCCGACAACTATTTTCCCCCGGTGAGCCTCTCGCTGGCGGAGGTGCAGCAATACCAAG
CGCAAGTGGAGGAAATGGTGACCAAGGGAATGGCGTCATGCTTGGACCACGAGGCGCGGGTCGCCGGCTTCGGGCTGGAGGACGAGAGGCGGTGGCAGGA
GGTCGCGCGCGACGGAGACCTGTCGATTGTGCGCCGCAAGAAGGGCTCAACGACCATCACGCGCACGTTCGGCACAGTCACGGGCGACTTTCGCCGGCTT
GTGGGCTTCTTCTCGTCCGAGACGTCCGAGCAGCTCTTCGCGTGGAACCAGTTCTTCTTCGGCTGTGCTGTTGACGCCGTTGTGCTGTGCAAGATGGACC
TGGACAAGTCCGAGACGCAGGCGACTCTAGGCATCAAGTGGACCTGCATGCAGCCTTCGGTGCTCACCAAGAAGCGCGACGAGTGCTTCCTCGAGTACAT
TGTCTTCAGGAAGGACGATCAGGGCCGTGACGCCGCGGTCATTGTCCGCATGCCCGTAGATATCCCGGAGTGCCCGCCCCTGTCGCAAGAGCTAAAGACC
AAACGCGAAAAGGTCACGACCGTCCTAGTTGTACGCGCGTCCGATTCCCACCCGAACGCTACCCAGATTTTCATGCTAACCGAGTGCGAGAACAAGGGAC
TCGTCACGTCTACCAAGTACTGCAAGAAGCTGCTGAAGGCTCTGAAGGACGTGTCTCTTTCAGCCGATGCCAAGCGTATCGCCACTACTATTAGCACGCC
TGGATTCGTGGAGCAGTCGCGGGTTGGCGGTGAGCAACAGGTTTTCGGAGACAACATCAAACCGTGGGTGCCCACGGGCATTCGCAATACCTGTACCAGT
TGCACACGGCCATTCCGTGCTGGTCACAGGCGTCGCCACTGCCAGCTCTGCGGGGACGTCCTCTGCTCCAAATGCCTCGTTCGACGCGCCGGCATTCGTC
AGGAGAAGAACGCCTTCACCAACTACATCGCAATGGCCAGCCAGCGGACGTTCCGCGTGGCGCAGGCGTTGTATTGTAAGGTGTGTGTTACCCGCTCCCG
TGAAGAGGAGGCGGAAGTGCTGCAGGAGCAGGCTGAGGCAGCTCGGCGTTCCTTGGCTTCTTCCAAGTCGTCAGTGCCTCGCCGGTCGTCAATGGGATCA
TCCACGCAGCCGCAAAGCTCTCGTTGCTCGACCCCGACGTCGTCGGCGCAGCACAACTCGCAGGCTCAACAACAACCCGACGTGACTCGACGCAGCGCCA
CTTGGATCGAGAAGAACCGCTCATCGTGGTGGTCCGAGAACGAGTCCGAAACCGGCAGTTGGAAGTCTGGATCCGGCCGCTTCAGCTCCATCTCGCGCAA
CTACAGCGGCGCCCCCACCGTGCGCTCATCAGTCAGCTCGGACTACTCGCTTGGCAGGAACTCCTTCATGGCAGTGCAGTCGCTCCAAACTCCGCGTGAG
GTCGAGAATGAACAGACTGATGACCACGTCGACGTGCGCCGCTCCAGCATCTACGAGGTGATCGACACCAAGGACATGGTGCCCGAGAAGCAGCTTCGAA
GCAAGCAGTCCTCGGTTTCGGCGTCGACGGATGAGATGTCTGACGACGACTTCTACAACGAGTTCCCTGACACGGCTCGTGCTCGATACACTTCGACGCC
CGTCACGCCGACTTTCATGTCGTCCCGCTCGACCGGCCGACGCACGCGCAGCACCGACCAGGGCGAGAACACCAGCTCCTCGAGATCGCTTGACCAATGC
CTCGCCGAGCAGAACGAGCTCCTGCAGCAAGTGCTGAGCGCGTGCGGCCAAGCTTCGTCCTTCAGCAGTAACAGCGGCATCATCGAAGACGACGACGACG
ATAGCCACGATGATGGCGTTTATGAGCTGTAA