Transcript Name :
Physo_309975
Orientation:
(+)
Number of Exons:
1
Description :
DnaJ-like protein subfamily C member 10
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
DnaJ domain8.8PR00625
DnaJ domain8.8PR00625
DnaJ domain8.8PR00625
Profile scan predictionP-Valprediction_id
DnaJ domain17.893PS50076
Zinc finger, DPH-type17.735PS51074
HmmSmart predictionP-Valprediction_id
DnaJ domain4.8SM00271
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
DnaJ domainIPR001623
Zinc finger, DPH-typeIPR007872
*** None ***
InsideOutsideTMhelix
1-156
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
2534
Sequence
        471 bases(100 bases per row)
ATGACGGCGCCCTCTTCTTTCTACGAGGTGCTAGGCCTGGCCGCGACCTGCAGCGCTGACGACGTCCGGCGCGCGTACCACCAGGCGGCGCGCCGCTACC
ACCCAGACAAGCGCGCGAATGACCTGAACGCGGAGGACGAGCAGCAGTTCCTGCGCGTGCAGGAGGCCTACGAGACGCTGCGGAGCGCCGAGCTGCGGCG
GCAGTACGACGCCAAGCTGCAGCAGGACGAGCTGGTGCGCAAGAGAGAAGAAGAGGTGGTCGTGGTCTCGGACGAGGTCCCGCTCGCAGACATGCAGCGC
GAGGTCCTGCCGGGCGAGGGCGGAGACGAGGACGAGGTGCTCTTCACGCACCAGTGCCGCTGCGGAGACCTGTACGAGATCACGGAGGAGGAGCTGCAGG
ACGGCGTGGACGTGGTGCCGTGCACAGGCTGCTCGCTGCACATTCGCGTGCTGCAGAACAGCGCGCGGTGA