Transcript Name :
Physo_322106
Orientation:
(+)
Number of Exons:
1
Description :
Mitochondrial Processing Peptidase alpha subunit
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-526
NN-scoreoddsWeighted Score
0.6332.1590.004
*** None ***
TypeScore
mitochondrial957
GO
*** None ***
*** None ***
Cluster Id
2310
Sequence
        1581 bases(100 bases per row)
ATGGTGTCGCTGCGCAGCCTCCAGACGCTGCGTCGTGCGGCCGTGCGCGTGGCCGGCAACCGCCTGGCGCCGCTGCAGACATTGCCGACGCGCGCCTTCT
CGCAGGCGCACACCCCCACGCAGAACGTGGATCCCAAGGACATCCTGCGGCCCGAGGTGCCCGTGGACGCCAAGCCGCAGCTGTCGCTGGAGCACGAACT
GCCAGGCCTGCCCCAGCTCAAGCCCGCGAGCCAGCTCAAGCCCCCACAGACGGAGATCTCGGTGCTGCCCTCGGGTCTGCGCGTCATCTCGCAGGAGACG
TACGGCCAGGCGGCCACGCTCGGCATCTTCATCGACGCCGGCAGCCGCTTCGAGGACGACGACAGCGTGGGCGTGAGCCACCTGCTGGAGCACCTCGGCT
TCAAGAGCACCACGTCGCGCTCGCACGCGCAGCTGGTGCATGAGATCGAGGACATCGGCGCCCTCACGACGTCCTCGTGCGGCCGCGAGCAGATCATCTA
CACGATCGACCTGCTGCGCGACAATGTGGAGAAGGGCCTGGAGCTGCTGGCCGACGCCATCCTCAACGTGGACCTCGTGCCGGAGGAGATGGAGGGCATC
AAGGCCATCATGCGCATCCAGACCGAGGACCTCATGGAGAACCCGCCGGCCATGCTGCAGGAGTTCATCCACGCGGCCGCCTACGGAGCCGACACGCCGT
TGGGACGCCCGCTGCAGTGCCCGCTAGACAAGATCGACGCGCTCACGGTGGAGAAGGTCAAGAAGTTCCGCGCCGAGCACTTTGTCGCGCAGAAGATGGT
TCTTGCCGGATCGGGCGTCGACCACGCGCGACTGGTGAAATTCGCCGAGAAGTTCTTCGCCAACGTCCCCGTTGCGCCGGAGGGTACGCCCATGGCGACG
CCCTCGAGCCCCGAGACGCTGGAACCGGTGATCTACAATGGGGGACTGTACCCGCTTTCGAACCCGGAGTCCGAGTTCTCGTACGCGGCGCTGGCGTTCC
CCACGGGTGGCTGGCACCACGAGGATCTCGTGCCGATCTGTGTGCTCCACACGCTGCTGGGCGGTGGTGACAGCTTCTCTGCCGGTGGCCCTGGCAAGGG
CATGTACTCGCGGTTGTACACGAGCGTGCTGAACCGCTTCTACTGGGTCGAGTCCGCCTTCGCCTTCTCGTCCATCCACGCGGACGTCGGTCTGCTCGGT
ATCTACGGCGCCTGCCTCCCGTCGCACACCAGCAACCTCGTGGCGCTGTTGTGCAACCAGATGCTGAGCGTCGCTAACCGGCCTGTCGACGCGATCGAGC
TCGCGCGTGCCAAGAACCAGCTCAAGTCGTCGGTGCTCATGAACCTCGAATCCCGCATGATCCTGTACGAAGACATTGGTCGTCAGCTGCTCACGTACGG
CGAGCGTGAGACGCCCGAGTCTGTGTGCGCCAAGATCGACCAGGTCACGGCTGCAGACATCCAGCGAATTGTGAAGGAGGCCATGCAGAACCCGCCTAGC
CTCGTTTACTCCGGAGACATCCCTCGGTTCCCGCAGTACCAGCAGGTCGTTGCTGGCATTAAGGAAGGGCTGAGCGAGTGA