Transcript Name :
Phymu_g2623
Orientation:
(-)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.8650.90321
InsideOutsideTMhelix
1-290
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        873 bases(100 bases per row)
ATGAAGTGCTTCGTCCCAATTCTCACGGCCATCGCGATGCTCGTAGCTCAAGTGACCGCCAACGGCGTCTGCTACGACCCCGATCACGGATACGCGGCCG
GCGCCATGACCGCTCAAAGCGTCAAGGACGACATCGCGACCATCCGAGGCCACGGGTTCAGCTCCGTCCGCACGTACATCTCCAAGTTCGGCTCCACCAA
CTTTGGTCTGGCcattgctgaagctggttaCAACATGACCGTCGCTCTAGGCGTGCCGTACCCCCAGGCCGACTACGTGGAGCAGATGGACGCTGCCCTC
ACGGCCGCCAACGCCGGAGGTGTGAGCTACATCTTTGTGGGCAACGAGAACCTTGCGGGCGCCACCAACGTTCCCGTCGAGATGATCGACACCATCAAGA
GCATCAAGTCGCTAGTCCCCGGCAACGTCAAGGTCGGTACCGTGCAGCGCAACACCGAGGTCATCAACTACGCCGGTATCTACGGCTGGTCGGACCTCGT
TGCGGCTTGTGATGTGCTCGGTGTGAACGTCCACCCGTACTTCACCCCCGGGACGACCGCCGACAATGCCATCGACATCGTTAACAACCAGTGGACGACC
ATGAAGGCGAACTTCGGTGACAAGCTCATTGTCACGGAGACGGGTTGGCCGTCGGACGGCACGCTGATGGGCAACACGGGCAGTGTCGACGGCACGAGGA
CGTTCTACAGCGACTACAAggcgtggagcagctccatgccCGAGTCGTTCTACTTCCAGATCTTCGACACCCCGTACAAGTCCACGCCGGTCGAGAAATC
CTTCGGTCTCCTCACATCCGACTCGAACCCCAAGTTTGATCTGTCTCAAGGTGCTGGCACTGTCCACTCTTAA