Transcript Name :
Physo_409482
Orientation:
(+)
Number of Exons:
1
Description :
related to transposases
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-269
NN-scoreoddsWeighted Score
0.8274.6590.009
*** None ***
TypeScore
nuclear522
GO
*** None ***
*** None ***
*** None ***
Sequence
        807 bases(100 bases per row)
TGGCTCACTGCATTTGAACATAGGCATCGCCTTCGCTACCGCAATCGACCCGGCGAGTCTGGATCCGCTGATCCCGCTGCTGTAGCTCAAGGTCGTCAAC
GACTCCAAGAAATCACGAATCTCTACCCTGCAAAGGACATCTACAATATGGACGAGACGGGGCTTTGCTACGCAATGGCCCCAGCTCGGTCTATTTCTAT
TTGTACGAAGCGGGCGCGAGGAGTCAAGAAGAAGAAGACCCGTATTACGCTTGCTCTCACGGTGAACGCTGACGGCACGGACGCACTACCGCCGTTGTTC
CTGGGTCGCGCCAAGCAGCCTCATTGCTTTGAGAAGCGCTCTGCAGAAAGCCTCGGCTTCTCATACCGGGCTAATGCGAAGGCCTGGATGACAGGACCGA
TATTCCGAGAATGGCTACACAATCTGGATCGGGACATGCGAGCGGCAGGGCGTCATATCTTGCTGCTGCTAGATAACGTGTCTTCTCATAAGACCGGCGA
TCTGGTGTGTACAAACATTCGCGTGGAGTTCCTACCCCCGCATACTACTACCTACTTGCAACCCATGGACGCCGGCATCATTGCACTGTTCAAGCGGGCG
TACAGGAGAAGGCAGATTCTCTGGGTGTACGAAAAGATCAAGGACGTGAAGAAGCTGAAGAAGAAGCCCTACGCGGTCGATCAGTTGCAAGCAATGCGGT
GGAACAAGGAGATCTGGCAAGAGCTGCAGGATAAGTCGGCCATCGAAAACTGCTTCCGCCATACTGGAATTGTTTTTAACGGTGTAGATGAAAGGTGCGG
CGATTCC