Transcript Name :
Physo_248333
Orientation:
(+)
Number of Exons:
5
Description :
ATP-binding Cassette (ABC) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
451-470
521-524
605-609
1-427
489-497
548-581
428-450
471-488
498-520
525-547
582-604
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2312 bases(100 bases per row)
ATGAGACTTGGTGAGCCAGACTCAGGCCAGTCTTTGACAACTACCAATGCTCAAGTCTTCTACGAATCCTTCGCGGACAAACTGGAGGAAGCGCTTGGCC
ATTCGCAACCGCATCTTGAAATCCGCTTCTCGGATCTCTCGGTATCCTGCAAGGCGTCCACGGTCAAGTCGCAGCGAGACGATGAAGAAGAAGCCTCTCC
GGAACTGCCGACGCTTTGGAATACGCTCAAGCGTGCAGCGGAGACCCTGCTGTCCTCAAGGAAGTCGGAGCAGCGTGTGATTCTCAATGGAGTGAGCGGT
GTGCTACGTCCTGGGACCATGACGTTGGTCCTTGGGCAACCGGGATCGGGAAAGTCGACGCTGCTCAAGGCGCTGAGTGGGCGTCTCGGACACCATGTTC
GGCTGGCTGGTGATATCACGTACAACGGCGTGCCTCAACACTCCATCGCCAACAAGCTGCCACAACTGGCGGCGTACGTGCCTCACACTGATCTCCATTT
CCCACTACTGTCGGTCAAGGAGACGTTGTCATTCGCGCACGTCTTCAACACCGGTGGAGGTAGTCACGCTACGGTGTTGCTGGGGCGAGACGCGGATCAC
GCGAGTCAACAAGCCCTCAAATCTGCCATCGACATGTTTCAGAACTACCCCGAGGTGATCAAGGAGCAGCTTGACCTGCAGAACTGCTGGGTACCATTGT
TGGCGACAACTTGGTGCGTGGCGTGTCGGGTGGAGAGAAGAAGCGCGTGACGACTGGTGAAATGGTTCTCGGGATGCAGCGTGCCGTGTTCATGGACGAT
CAGCACTTGTCATGTGACTAGCGCTCACGATGGAAAATTGAGGAGTGAATTGATTCTTTAGTCTGCTACGCCAGCTACACTCTTGTGGCCATTCATTTTG
GCTCGTAAACTACAGTGAACAAAAGTAAACAACAGGACTTCATATCTACAACGTGGTCGCAAACACTGCATAAATCCGTGCGACCAGATTCGATCCACGA
TGTGCTCAACGGAGGCATTGCATCCGTTACAGCACTGGGCTTGACAGCGCGGCCACCTTTGACATCATTCACACCCAACGCACCATCGCTCGGACCCTTG
GCAAGGCAATAGTGATTTCGCACTTGCAGCCGTCCCCTGACGTGTCCGCGCTCTTTGATGACATTATTCTCCTGAACGAGGGCGAAGTGATGTATTATGG
GCCTCAAGAGATGGTTGTCGAGTACTTTCGTGAGCTGGGACTCAGCTGTCCTCCGAACCGAGACGTCGCGGATTTCTTGCTGGACCTCGGAACTTCTCAG
CAGTACGCGTACGAATCCACGTCGACTGCTGGTCCTTTTGGAGGAGCAAAGGCTCCCCGCCTAGCGAGCGAGTACGCGGACAAGTTCCGTTCTTCCAGCA
TTCACCAGGGCAATCTCAGTCTTTTGGCGACTTTATTCAACCATGAAATTCGAGGCAAGTGGAGTGAGTATGCCGAAGCAATGCCACAGTTCCAGCGATC
TGTGTGGGCGAACATCCGTACACTCGTGGCTAGGCAGCTGATGCTCATCATGCGGGACGTCAACACGGTCCGCAGTCGGATGGTCTTGGTCCTATTGACG
GCACTGGTGGCAGGCACGGTGTTCATGGACGCGATTCCCACGAATGCGCCGTTGGTGCTTGGAGTGCTCTTTGTGTCGGGGCCCGCTCTTTGAACAGACT
TCGCAGCGCTCGATGTTCATCGAGATGCGAGATCTTTTCTACAAGCAGCGATCGGCGAGCTTTTTCCAGACGTCTGCGTATGTGCTCGCGAAGTCGTCAG
CCAAGTCCTGATAGCGCTACCAGAGAGTTTCGTTTTCGGAGCCTTCCTGTACTGGATTGGTGGTCTTGAGGCTAACGCCGGGAGCTTCATCGTGTACGAG
CTCGTCGTCTTCCTTATCGTCATGGCCGCCGTTCTGATCTTCTTCTTCGTCGCAGCGATATCTCCAAACATCTACGTCACGAACCCGCTCGCTCTAGGAA
TTCTTCAAGTCATCCTGGTGTCATCGTCACTAAGGAGCATACCTGTCGTGGCTCCATTGGCTAAACCCGATGGCTCGGGGTTTCCGTGCGCTGGCTGTGA
ACCAGTATCGGTCTGCAACATTTGATGTGTGCATGTACGAGGACGTGGACTACTGCGATCAGTTTGGTAAGACTATGGGCGAGTACTACTTGGGTGTGTA
CATCATTCCGCCGGGGAAGGAGTGGGTTGTCTTCGGCATCGTTTACCTCATCGGGCTGATCCTCGCATTCACCATTCTCAGCTATCTCGCACTCGAATAC
AAGCGCTACTAG