Transcript Name :
Physo_322104
Orientation:
(-)
Number of Exons:
3
Description :
Voltage-gated Ion Channel (VIC) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Potassium channel2.2PR00169
Potassium channel2.2PR00169
Potassium channel2.2PR00169
Potassium channel2.2PR00169
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
163-173
293-374
1-139
197-269
398-557
140-162
174-196
270-292
375-397
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
potassium ion transportGO:0006813IEA
*** None ***
*** None ***
Sequence
        1995 bases(100 bases per row)
ATGCGAGACTCCACAGGACCCGTGGAGCTTTCAGAAACAGCTCTGAAGCTGTCGAAGGTGATCGAGCGCGAGGCCAGACGCCGGTCAGAATTGCACAGCT
CCCGGAAAATCCGCCTTCAATCTCATTTCCCGTCGTTTTCAAGGATGAAAACTGTGGAGCAGAGTCAGCGAAGCCAGCGGAGTGTACGCAGTCGTCGATC
GATGTCGGTAACACCGACACCAGAGGAACCCACTATAGTCACGACAGTGGAGGGCAGTAGTCCTGAACTACCGGCTGTCGACTTGTCCAACGGCACGAAA
GGAACTCTAACTCGGCAATGTTCTAAGACTGTCTCAGAGTCCCAGGCCGACGATGGCGAAGAGCCCACGAGTTGTATGCACAAGGTGTGGGTCTTCTTCG
AGGACCCTCAGTCGTCTACTCCTGCGTACTACTTCTCGCTGAGCATCTATGGATTCATCATATTGTCTACATTCGTCTTTGTTGCTGAAACGGAGGCTGT
GTTCGACCCCTACATGTCGGTGCTTAATGCTCTGGAGGCCATTTGCGCTGGTGTCTTCTCGTTTGAACTCGTTGGTCGCTTTCTCGTGTGTCCCAGTAAA
CTGGTCTTCCTCCAAGGTACGCCGTTGTTTATTCATTAAGATCATTACTATTACCCGTACGCGTTTGTTCTGACAACGTTTTAATACGTCACTCTGTTAG
ACATCTCCAATTGGGTAGACTTTGTTGCAGTCTTCCCTTTTTACATGGAGTCATTGCTGGCTTTCGACAATGCTGGATCCCTCGGGGCCATTCGAATCGT
GAGACTTACCCGAGTGGCACGGGTCCTGAAGATGTCACGGTACTCATCAGCCATTCAAGTTTTCACGCAGGCTATCTCCATCAGTATTAAACCGCTGACC
ATGCTGATCTTCCTAATGTCGATCGCGATGATTATTTTCTCTTCTGCCATCTACTTCGCGGAGTATACAAGCGATGGTTGTCGTGCGGATGGCTGGATGG
GCAAGTGTGACGGGGACGCTAAAACTTCCGACGTGGTGTATTCCGTCTCTGCTGCAGCGGCAGTCGCATCGGTGGAAACCAGTGACGCTTGCGTATGCGT
GGATCCAAACCCATACCAAGGCATTGCCACGTCTTTTTGGTGGTGCATCGTCACCATGTCAACTGTGGGGTATGGTGACATGACGCCTGTGACTTGGACG
GGTAAGGTGGTCGGATGTTGCACTGTTCTGACGGGCATGCTTGTGCTCGCGCTGCCGATCACGGTTATCGGTACCAATTTCCAGAAAGTCATGAAATCGG
TCATGCACGAAACCATGAAAAGCAATGTGGACTTCCTCAAAGGGAAACGCATGATCTGCCGCAACGAGATTGAAGCCATCCTAGAACGCTTCCATGCTGT
CACGGAGGGAATTCATCTCGACATCGACGATGTAATTAACGTATACGACACGGACAACAGCGGTATGCTCGAGGACGACGAACTCGCAAAGTTTCGCAAC
GATCTCGAAGTTCTACAGAACCGCGCCATTATGAACCAATTGGTTGTGCCTGGTGTTGGTCTCCACCACCACCACCATCGTCCATCGTCCACACACCCAA
GGCATCGATCAGGTGCGGTGACCATTGCACCTTCGCCTACAGAACTGTTGCTGCAAAGCAAAGCTCGTACCGACAGCGTCGGGCATCGTTTATCGAACGG
AACGATATCCTCACGGCCATCGACCGTTGTTGGTACTGACCCGAACGCATTTATCGACCCCTCACCTCAAAGTGGGCCCAATGCTGATGCTGCAGGTCTT
GCTCAGCCCAAAGTGTCATCGTCCAGCTCGTCCCCTCTGATTATGCCGGACAATGAGCTGCTGCTTCGACTGCTCGATATGCAGGAGAGTTTCCAGGAGC
GGCTTCTTGAAACCGAGCAGCGGCTCGAGTCCAAGCTCAACAACCTGACCAAGATCCTCATTCGGCTCGAAGGAATGATGGAGGACGAAGACTGA