Transcript Name :
Physo_145317
Orientation:
(-)
Number of Exons:
3
Description :
reverse transcriptase
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Integrase, catalytic core16.528PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
TypeScore
mitochondrial609
GO
Biological ProcessGO IDPrediction Method
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        1969 bases(100 bases per row)
ATGTCATCATCGATTCGGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGATTCTATCAGATCCTCATGTGTGAGAGCGATATCCCTC
GCACGGCTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCACAGGGTCTGAAGAACGCCCCTGCGACTTTCAACAGGTGCCACTTGTT
GCGCTCGGTGCGCGACTTCGCATCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGAGCTGCGGACGGGATGAGCGACGTTGAGATGCACAAGGTGCAT
CTCCGCAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAATGCATCTTCGGGGCGAGTGAGATACCCGTGCTCGGGTGTCTCG
TTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAATGTCAAGGAACTGCGGCAGTTCCTTGGCTT
GGCCACGTACTTGTGCACGTACGTGAAGGACTACGCGGGCATGATACGGCCGCTGTCACAGCTCCTGAAGAAGGACGTCAAGTGGATTTGGACTGCTGAG
AGTCAGCAGGCCTTCGATGCAGTCAAGCAGGGCTTGACTGAGGCGCTGATCTTAGCGGTGGCCGACCAAGATCGCCCGTTCCACATTGTGTGTGACGCAT
CCGACTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACCAATCGCGCCAGCTGAAGCCAGCTGAGCGCAAC
TACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGGGTATCTACTCAGAAGCAAACCGTTCGTGGTCTACACAGACC
ACGCGTCGCTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAA
ACCCGGAAGACTCAATGTTGTGGCTGACGCGCTCTCGCGTCGACCGGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCGATCGAGC
ACCCCAACGTCGTCACTGTTGGACGACGCGAAGGTCGCATACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTTAGCGCCTTCTGAAAAGC
TTGTCAGTAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTACCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGACCGC
GTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTACGAGTATCCCGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTC
TTCTCACGCGAGACTTCTACTGGGCCCACCAGTACAAATGGATGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGC
GCAGGCTCCCTTGCAGTCACTACCAACTCCACGAGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGTCAGGGGAACACG
GGCGTTGTGGTCTTTGGTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAGCGGACTGCAGGTCTGTTCGTCGACA
TGGTGTTTAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCGCACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAG
TCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCCTACTCG
TTCCTACTCCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCCTTCTACGTGA