Transcript Name :
Physo_125777
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3588 bases(100 bases per row)
GGTGGAATTCCAGGAGTGGTGGGCGCGATAGACGGCTCTCTAGTGGAGATTAACAGGCCCGAGGACTTTGAGGGATACTATTGTCGAAAGATGTTCCCAG
CGCTAAATGTGCAGGCTGTTGTTGACGACAAAATGCGCTTTACTAGCGTGGAGATTCGGCCGGGCTCGTGGTCTGACCAAAAAACATGGCGTGCGTCTAC
TTTAGGCTCCAACTTCAAAGACGTTTTGCTAGCGGGGACCCACTTTTAGGAGATGCAGGATATGCTATTAGTCCGGCTATCATGGCGCCGTTCATGGAAA
ACGATGGAGCCGGTTTGACACGCAAGCAGCTACGTTACAATTATCTGCATTCCCGAACTAGGATGACAGTCGAGTGTGCTTTTGGACTCTGGAAAGGTCG
CTTCAGAATTGTAACTGCTGCATAACACCAAATGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGGGGTAGGCTTACCGGAGACGAGCGAGACTGAGACGATCATTCCCCGACCAGGCTCTTATTGCATTCACAAGGGTTATATTGCATTTATT
GAAAAATGAAATGTCCGGGTTACTCGGTCCCTAGTTCGTAGCACCCGAAGTGCTCACTACGTCTAGCCTTATGTCGTCCACTTGCTATTCTGCTGAAGCT
TCACGCTACCGCTGTTGTGTCGAAGATATGCATTAGTTGGGAACAATGTTGTGCCCCATTTGGAAAGAGAAATTGATCGTCCTGGCAAGAGCTTCAACTT
CCAGGACAGTCACCTCATCTTGATCCTCGTACGCGATCTCCCAGAACCGCTTTCCACCACGACTGAAGGGGGGGTTAATTTTGCCAATATAGGTCCGCTG
GGACTCCTCGCCATCCGCCTCGGTCACTGTCTTTTCGCTTAGCACGCTCCAGTTGATAACACTTGCTGGCTTGTCCACAAGTCGTTTCATCAGGGCATCG
ACGGAGTATTGGGATGTTCTCACACCATCTCACTGGAGGCATTTGCTTTTCTTGCGCGGTCTACCGGGAGGCCTGCGAGTTGGGAGCCCACGAAGCATCA
CCGTCAAATCAAGATTGTCAACGAGGTGAAGGCATGCTAGTACATGAGCACACAGCCACCTCGTCTGGTAGAAATCTTTGCAGTCACACTTGAATTTTTT
TCTGATGGTGTTGATCTCCTCCAGGGACCACAACGGAGAGTTCCAGTCGTGCTCATACGGAAGTCGATCCAACACCGCCACCTTGTGCAGTGAGAGGTAT
CGAAACTGGACATTCTCCACAATTTCATCATCCTTGAGGGATCCGCTGACCGATCTCTCATAGGTCTTTGTTCGGCTCGCGTTCACCTTCAATCCATGCA
CATTGTCGTCCCGGACGATGTAGTATCTCTGGTTGAAGTAATACGCCTGGATGTTGCGGATTGCTCTGCGCGACTTGCGTTTGTGAGTCGGGATGTAACG
GGGTTACACGCAAAAGTGGCTACAGTCACTTGTTACTCTAACAGATGCGATGTCTGTTAGAGGTTTGAACACTTCCTCGACCTTGGTGTAAGGTACACCA
ATGTCTACATACATTTAAGACCACCACGACGGGTGGTCTATACACAGTTAGGATTCCTATTGGCTGAAAGCAGTATCTTTTAGCCAATGAGTGACTTGCA
TGTTAGCAGAATCCTGCCAACCAGCCGTTGGCAGGTTCCTAGTTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCAT
TTTGACCCAAAAACATTATTTGGATCATTTATTTAGATTAATCTATACTCGGAGGTCCGAGTATAGATTAACTCTAGTCTAAACTAAGCTACGCTTCCTC
GTACACGTGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACGGGAAGTGGTTGTCGTCGTTGCAGAGGAGTACACCAGCTTCTAG
AACCTCTGCGGAAACTGGCCCAGCGGCAAAGTGCTGGATAGGCTCCGACCCAATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCAGTTTCTAGATGCTCTATTGTGTAGACCATCACGCGGAAAGGTTTGCTCGCGAAACTGCCACGTGTTGCGAAAGCAGTGGTGTCGAGACATCG
GTCCGTGTCGAGACAAGCTGTGCCAGCGCTGGCATGAAGTCGATGCTCACGTCTGGCGCTGTCAAAACACACACTGTGAGTACTCCATCCAAGTCAAGCT
ACGAGAGTCGATGCACCAAATTGAGCATCAGCATGAGCGAATCGACAGTGTGCGAAGGGAACTCGATGAGAGAAAGAAAGAACTGACCGAAGCCAATGCT
TCTCGATTGACCAATCCGCCAAGCAAAATTTCTTTCTTAAGCAAGCAAGTGGACTTGCTTGAACGAGAATTAAGAAGCGAGCAAGAGCAGCTGGAATTTT
ATCAGTCTTTGGAGAGAGGGAATCTTGAAGCTGCAGAAGAAGCCGACATCAACCCACTAGCTGGGGACTTCCAGATGCATTACATGGTGAAAACACGGGG
TGAAACCGCTGCAATAGATGATGGAGTGCGCACGAAAGAAGATACGAACCAAGTGGTTCCAGCTCGCCGACCAGTCATCGAAAAGGATGAGCTATTGCCT
TCGTTGGCTGACCCGATTGGAAAGCTTTGCTACGCAGGGCAGCGTACCGCGGATGTTCAAGGAGTGTCTGCGGAAGTCCATTAGGTTT