Transcript Name :
Physo_143014
Orientation:
(-)
Number of Exons:
1
Description :
reverse transcriptase
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, CCHC-type8.68PS50158
Reverse transcriptase12.34PS50878
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
zinc ion bindingGO:0008270IEA
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
*** None ***
*** None ***
Sequence
        3921 bases(100 bases per row)
ATGCCTGACGCGTCCCGGACGACTGCCACTTCACTCGAGCACGCCAGCTTTCCGCACCTGTCGGCGACCGAGTGGGAGGCGCTACACCTCCTCGCAGCGG
TGTCTGGTGACGCTGTGATCAAGACACTGCTGACGGCAGGAACCGAGGAACAACAACGTCTGGCCGCCCAGGAGTTCATGGCGCGTGAACTCGCTGACCT
CCGTCAGCGAGTGTCGACTCCCACGCAGACCAAGAACAAGTCCGATATCGTGAAGCTCGATGTCTCCACGTACAGCGGTGAAGGCGAGGGCCGCCTTCAC
CTGAACCGCTGGTTCTGCGAGGTGGACATCGCGATCGAAGCTCGGCAGCTGTCTACCGAGCTCGCGCGCACGCGCTTTCTCCTGTCCAAGCTGGCGGGTA
AGGCGAAGGAGTGGGCGCTCGGCAAGCTCGTGGCCGACGCTTCCTGCTTCCCGACCATGGCATCGACGAAGGCGGACTTGCGACTCGCGTTCGAGCCGCC
CCAAGATGAAAGCGTTCAGCGCTCCGCCTTCCTGGCATTGAAGCAAGGCCGCATGTCCATGTTCGAGTACATCCAGCGCGCAGGACACCTTGTGTCGTGC
ATCACAACGCATCCCGTAGACATGGCGACCCAAGTCCACGTCTTCATCTCCGGCATGAGCGCTGGCTACCAGCGCTTCTACCTGACCCGGAAGACCCCAC
CGACACTCGAAGAGGCCTTCGCTGTTGGGCTCCGTGAAGACTACGGTGTGACGGCGTCGCAGGCTTTCGATGTCTCTCGGGCCCCGGTGCCCGAGCCGGA
GCCGATGGAGGTGGATGCGATTCAACAGTTCGGTGGACGTCGGGTGCCGACATCATCAGCAAGGCCGCCAACGGCCTCGTCAACGTGCAGTCCCCGCCCG
ATGCGCTGCTGCCGCTGTGGGAAACCTGGACATCGCGCGGCTATTTGCCGCGCTCCGGCGCCGATGCAGGCGAACGTCACGGTCGCGAACGACGTCACCG
CTCCAAAAAAACGGCGACAACCAGTAGGTGCGGGGCGCTCTACTGGTTGTGGAAGGAGAGATGGTTCTCTGGTGGCAGAACCTCCTCCTAGCCCTCCCGT
GCTTCATGCACAACTCTTTGCCACCACCTCCGGCAGTGACACGAGGCTGATTGTGCTTAGTCTCCATGTTGACGGCGCGACGCGCCCTCTTCGCGCGCTG
CTGGACTCGGGCGCAACGAACAACTTCGTTCGCGCCGAGAGCTTGTCGGTGTTACCGGCGGACTTGAACATTCGCGACGGGCCTGGCGACATGATCGTGA
AGTACGCTGGTGGGAAGCCACGGCGGACGCCGCGGCGCTCGGTGACCTTCGCGTACGAGTTCGACGGGTTCCGCAGTTCCGAGGAGTTCTTGGTGATCGA
GCTGAGCGGCTCGTTCGACTGTGTCTTCGGCATCCCGTGGCTCGCTCGCCACCAGCCTGAGATCAACTGGCTGACTGGCACAGTCCGCCTCCGAGACATT
GATGTCAATGCAGTATTTGCGTTTCTGTGCGGAACGCCTAACCAGTGGCCGCATGTTGCCGTCATGGACCCCGACTCAATGACCCATGCTGCGCACGAAG
CGAGTGATGGCCCTTCGTGTGCGGTGTGCGAACTCGCAACCTGCGCCGGTCCTGAGCAGGAGCCTCAGGACGTGTCTGACGTGGTCGAGCATGGGTTCCC
ACGTCCCGATGAGCAGCGGTTCTCGGAAGCAGACAATGACGTGGTCGAACCACGTCAGGACGAGCAGCGGCTCTTCAAAGCTGAAGTACGAGAAGATGTG
GTTGAGCGTGGCCTCCCACACGCGGTCGAGCATGGGTTCCCGCGAGTGGTCGAGCGGGAGCTCCCTGATGAAGTCGACGCGGTCGTGTCCAATGACCCGC
GTCCAGGCGCCGACGTTGTGTCCCGGCGCCCCAGTTCAGCGGCCGTGATCGAGCATGGGCTCTCATCGGCAGCTTCGGACAACACTCCACGTCCGATTCG
ACGTCGCGAACGTCGCAACCTGCGCCATCCTCGTACGCCTTCGGCGGACTCAGTTGAGGCTGAGGCTGAAGTGATCTCATTCCTGGTGGGGGACGACGCG
GAGGCGCCTCCGCGTGTACGCGACGTCGAAGTCGCACGTCCACCGTGCGACGCCGCCGAGATCACTCGGCTGCCTGGGCTCTCGTGGAAACACTTCCTCC
GTGACCTGAAGAAGGGCGAGATCGAGCAGGTGTGCATGATCGTCGCTGAAGACGCCGAGTCAATTGCGGCCGTCGCAACCAGTGCGTCGGACCCAGCTTC
CGACGCCAGGACGCGCCCAAAAGGAGGCGAGCTTAAGAACGCCCGTCAAGCCCGCTACGCAGCTCAGTCGTTGCCGGCGTTCGAAGCGGCCGGCAACCCA
GTCGCTCCGCTCGTGCGCGAGTTCATGGAGATTTTCCCGGACAAGGTTCCAGCCGTTCTTCCACCCGACCGCGGTGTTCGGCACGAGATTGACCTCGTGC
CCGGTGCGAAGTACTGTGTGACGCGGCAGTGGCCGCTTCCTCGCGACCAAGTCGAAGCCATTGACGCCTTCTTCGAGAGTCGCCGGCAAGCCGGCCACAT
TCGCGAGAGTCTCTCGCCGCACTCCAGTCCGACGTTCTGCGTGAAGAAACCAACCGGCGGCTGGAGAATCGTCCACGCCTTCAACAAGCTCAACGAGGCC
ACCATACCGGCGCAAACGCTGATCCCGAGGAAGGACATGGTGCTGGACACCATGTCTGGCAGCACGAAGTACAGTGCCATTGATCTGATGGATAGCTTCT
ATCAGATCTTGATGCGCGAAGACGATGTGCTGCTAACAGCGGTCAGCACGCCCAGCGGGATGTTGTGGAAATGGCTCGTGATGCCGCAGGGGCTCAAGAA
CGCCCCCGCCACCTTCAATCGGATGGTGTCCAACTTGCTTCGGCCGTACCGAGACTTCGCGCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCC
GAGGACGGCATGACGGACGTTGAGATCCACCTACAACACCTGCGCAAGGTGTTCGAGGTGATGAAGGAGAACAAGCTGTACGCCAACTTGAAGAAGTGCA
TCTTCTGCGCTCCCGAGATCCCTGTGCTCGGGAGCTACGTCAGCAAGGACGGTGTCCGCGCCGACCCCGAGAAGATCGAGGCAATCTGCGCGTGGCCGAC
GCCGCAGGACCAGAAGCAGCTCCGGCAGTGGCTGGGGCTCGCCACGTATCTTCACCATTACTCGACGAACTTCGCTTCGACGATCCGCCCGCTATCTCAA
CTCCTCAAGGCAGACGCCACGTGGTCGTGGCGTCTCGAGCACCAAGCTGCCTTCGACGCGGTGAAGTCGAACTTGGCCACCGCGCCTGTGCTCATGCTTC
CAGACCACTCGAAGCCCTTCCATGTCGTGTGCGACGCGAGCGACTTCGCGATCGGATGCGCCTTGATGCTGTTCGATGACGAAGGACGCGAGCGGGTCAT
CAGCTACCGGTCGCGTCAGCTGAAGCCGGCGGAACGGAATTATCCGGTCCATGATAAGGAGCTGCTGGCCATGCGCTACGCCCTCATCAAGTTCCGCGTG
TATCTCCTCGGCGAACAGACTTTCGCGATCTACACCGATCACGCGTCGTTGAGGACAGCGACGAAGAGCCCTCACTTGTCCCAGCGCATGGCGCGCTGGT
TGTCCCTGTTCTCCGAGTACAACTTCGTCGTGCACTACAAGCCGGGCAAGACCAACATCCTTGCCGACGCGTTATCGCGTCGGCCTGACTACGTGCAGTC
AGGTCGCCACACAGTTGGTGACGAGGACGACGACGAATGCGCCGTATGCACTGCCGAAGACGTCGCTGCTGTTGAGGTTGCAGCGACCAGTCCGCTCCGT
GACTTGATCGTGGACGCGTAN