Transcript Name :
Physo_140839
Orientation:
(+)
Number of Exons:
9
Description :
PREDICTED: similar to Myb proto-oncogene protein (C-myb)
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Myb domain27.883PS51294
Myb domain16.84PS51294
Cyclic nucleotide-binding domain11.728PS50042
HmmSmart predictionP-Valprediction_id
SANT/Myb domain1.5SM00717
SANT/Myb domain9.7SM00717
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Cyclic nucleotide-binding domainIPR000595
Myb domainIPR017930
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
chromatin bindingGO:0003682IEA
KO ID
K09421
K09421
*** None ***
Sequence
        4290 bases(100 bases per row)
ATGAACCGCAAGCTGGAGCTCATGGAGCTGGAGGACGGCGGCAACAGCAACAGCAGCGGCGGCAACCAGGAGATCCCCCTCATGGAGGTGGCCCACCACC
CAGACGTACGCCCGCCTGATTAACTGTAGTAACTAGCACACCGTAGACGGTGCTGACTGGGTGTTGTTGTTTGTTGTTGCGTTGCAGCTGAGCTACCTGC
GGGCGACGGCGACCCACGGCGGCTCCGTGAGCAGCACGACCAGCAGCAAGTACGGCAGCCCCGAGGAGTCCTTCGGCGAGGAGGACGACGACAACAACAG
CAAGAAGGCGGTGCGCCGCAAGACGGACTCCAACAGCAAGCGCCCCTGGACGCGCGAGGAGAACGACAAGCTCATGCAGCTCGTCAAGCAGTACGGCGCC
AAGCGCTGGTCGCTCATCGCCATGCACCTGCCCGGCCGCGTCGGCAAGCAGTGCCGCGAGAGGTGAGCGGCGTCGGATACTAATGCATATGTGTGTACTC
ACGCTACCTTTTTGCTGTGCTGCTCTAGATGGCACAACCACCTGAACCCGTCCGTACGCAAGGACGCGTGGACTGCAGAGGAGGACTACGTCATCTTCGA
GTGCCACAAGAACGTGGGCAACCAGTGGGCCGAGATCTCCAAGATGCTGCCCGGCCGCACGGACAATGCTATCAAGAACCGCTACTACTCGACCATGCGC
CGCATGCAGCGCCAGTCGATCCGCAAGAAAGGCCCCATGCGCGAGGGCAAGAGCATCCGCGTGGCGTCCGTCGCGTCGTCCCCCGTGCAGAACAACGGCA
GCCAAGTTGGGCCTGCCCCCATGCAGCAGCGACCCTTGAACGGAGTCATGCAGCCGCAGCTCTCCCCCCAGCAGCAGCTCCCACCGCAGCGAGGGGTGGG
TTTCCAATCCACTTTTCAGAAGCTTTTCTCAGACGTCCCTGGGAACGCCGCACGCGTGAGTTCCTATAAGGGAGTTATGATACAGTGAGGACAGTCGCTG
ACCTTGTTGTTCTTGATTCATGTTCTTGCAGGCGGATGGCAACTCCATGGTCGACTTTGAGCGCTCGAGCATGATGGCCACTTCCCTACGACAACCGACC
ATGGTTTACCCCGTCAACGGAGGCTACTCGAACGGGATGAACCCGGACTACAGCCGTCCCATGTCCATGACGTCGTCTCCTTGCTCGGTGTCCCCCGCCG
ATGATATGAACCAGAGCAACCAGAATGAGGCCTTCGACTACGTTCCCATGCAGGCACAGATCCAGCGTCTTCGATCGTCCAGTCCTGGGTCGGTTGTCAT
GGGCACGCCCCCTCCTTCGACGTCGATGGGCATGATGAACTCCCCGTACGGCTCGCCGGCAAGCCACATGCAGCAGCAGCAACAGCAACAGTCTGGCAAC
TACATGATGTCCGGGAACCCGTATTCTAACAACAACGTGCGTGGCGGCATGTACTCGAGCCCGTCCAATGCAGGACCTGCGCAGCAGTACCGTCCGACTG
ACGCTCCGCCCGTGAACCTCCCCCACAAGCGTATCCTCGACGTTCAGGGCTCGCAGCGTGACATGTGGAAGAATGACAGTCCTGTATCCGTGACAGCGCA
GATTTTCCGCGGCATGCCGGCCCAGCACATGCAGCAAGGCCAAGTCAGCGAGCCGATGGCCATGCAGCAGTCCAAGCCGGTGTCCATGCCCCTGTATAGA
CAAGCTCCCAGTATGGGCCACTTCAACAGCATGGAGCAGGTATGGACCGATGATGCCTATCTGTGATTGTACTACTTGAAGCCGGGAGGGGAAGACTCGA
CCTCCTCCTCCCTGTGTGGTTTGCTCCCATAGACTGCATGTACATTTTCTTAAAGTTATTGCTAGAGGCGAATGGCAACGTCTTCTCTTACACCTGTATT
TTGTTTCTTGTGAATGCGTTTGTGTGCCATGTAGAGTGATGACTCGCCCAGAAGAGACCAGAGCGAATGCATCGTCAAGTACGAGTTCTGAAGACGTCTC
GACGGTGAAGAATCTGGTAACGCTTAGTTCTATTAGTGTAGCGCACGTCGACTAGTACAATTCCTTCGAAGTTAGTGTTTGGAGCCAAGCTCGCTATTTG
AAGTTCACTAAAAATATTGAAACGTGGGGCAAACGACCCCGTTCTTAGCGGCCATGAACAACAAGCGGGTTAGAATCGCGCCATAATGCTGCGTAGGACG
GGAGACAATGAACTAACTGACGTGCATCAACGCAGCGGATGGCAATGGTACAGGGAGTCACGCAGCATGCAACAACCAAACTTGGAGCGCGCTTCCATCT
GCGCGCCCTCTTCCTGCGGCAGCTCGACTTCTCCATCGACGAGTTGAACTTCATCGTCACGTACTTGACCAACGAGACGACGATCTTGGAGCAGCCATGG
TGGAGAGGGCTTTCACACACTGATCGGTAAGGCGTGACTCACTCTTCTCTCGCTTGAGTTTGTTTTGCTGACTCCGGTTCTGCCGGTCGTCTGCTGTAGT
CTGGAGACTGCCAGTCGGATGAAAATGCAGCACCTTCGTCGCGGAGAAGAACACGTTATCTGGCTCACCTCCATGGACGCACCTCGATCGTGTATCCTCT
TGTACGGCAATGCTGAGGCCAGACCATTCAATCTCGCCACCGCCCCCGTGTTAAACTTCACAGAGGGCTCCGTTGTAGGAAATCTCGGGGCCTCGCCAAG
GATGCGCGTACATCACGAATCGAAGTCGTCAGGGTCGAGCCACGCTTCGTCTTCGACTACTGCAGCCACCGCGGCTGTTGGTGTCGCGGACAGCAAATGG
AGACGCATCAAGCGCGAGAACACGCTGCGCAACGACATCCACTTGTACAACAAAGTCATCATCTCCGGTCCGGCTGACTACATCGTGGTCACGGAAAGTG
ACGTTCGGGAGACCGGTTCGGGGGCTGCAGACCGTCTCCAATGGGCCAAAATGTTCGGGCTCGAGAGGTTTGTGGGCTGCCTCCGCCAAGCAGTCTTCGA
GCCGGGCGCGATTATCGTCCGAGAGGGTCATCAACTCAGTCATTTGTATCTAATCGTTGAAGGCGAGTGCCGAGCTTCGGTCGAGCGTGATGACACCAAC
AGGCCAAGCACTGTCCAGTTCACTGATGCCTCGTCAACCAGCTCCAAGCTACCGCTCACAACCGCAGAGGCCCAACTACGCCACGCACGCAAATTTCGCT
GGAGCGACGATTTTCAGCTGCCTGTCGCCTCTCTCGGCCAGAAATCTGCAGTGGGAGACATCTCACTCGTGCTTGGAATTCCGGAGCCCACTACCGTCCG
AGCTGTCACCACAGTACACGCCCTCTCATTGTCCCAGGAAGATTTCTTGCGCGAGAGCAGCGATCGGCATGATCCAGTCGTGTTGGCGTGCATCGAAAGT
AAGTGGCTGGTCTGATCGAAAGTTAATGACGAGTACTCAATCAGGCTAACAAGTCGTCGCTCTTGAACGTACCCGCAGAATTGCAGAGTACGGCATACGA
CACTCTGCGGTTTGTACTGGAGCGCGTCGAAATCGAGGCCAAGAACGAGCACTGCGACCAGCGCCTCAAGATCGATTTGCTGCGTGACATTTTGCGCCAC
AAACAACCAGGTACTTCCCCACCTTGAACGATCCACCTCTCCGATTCGAGTTCACTGAACCAACAACCTGTTCCGCAGTGATCCAGGGGGACAAGCAGTT
GTCAGATCTGTCGTCAGTCTCCAGTGCGAATGGGCGGGGTGCCTCTGCTGAGCGTACCTCCTCTTCGTATGATTCCGGTCGAGCACAATCTCCTGCTGGG
ACTTCCACCGCTGGAGTTCCATCCCGCGTCATGTCACTTCCGTCGGTAGTATTGAGGCACGTCGCTGCCAATGCGGAGGACAAAAAGCTGCGAGCTCGCA
ACCAAATCGGCAATTTCGCCGCCATCTCCGGTGAGGACGTCGTTGAACCCGTCGAGAGCCCAACACGGATGACTCGGCAACAACGGAAGGCAGCGCGGGC
CTTCGCGAACTTGCAACACCCCGTTGCTGGCAAGAGTCTCGGAGACTACGTGCAGATGCCTGTCAAAACTACCATTGTTGATACACTCGCCGCAGATCAG
CCCACGAAGCCGGCCTCGGACGATCTTCTCTTCCTGTTCCCCACTGTAACCAAGCGCCGACAACTCCACGGGAAGTACGTACCGTACCAACGCCGTTTGC
TTATCGTCACTGACACGATTGCATGGTGATGGCAGAACACTACCCTTGCTACCCAGGTATCGAGGCTATGACGCCGTCCCAGCAGAATAG