Transcript Name :
Phymu_g1796
Orientation:
(+)
Number of Exons:
7
Description :
hypothetical protein PHYSODRAFT_463651
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Kae1/YgjD family1.4PR00789
Kae1/YgjD family1.4PR00789
Kae1/YgjD family1.4PR00789
Kae1/YgjD family1.4PR00789
Kae1/YgjD family1.4PR00789
Kae1/YgjD family1.4PR00789
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Kae1/YgjD familyIPR017861
*** None ***
InsideOutsideTMhelix
1-346
NN-scoreoddsWeighted Score
0.5281.1080.002
*** None ***
TypeScore
cytoplasmic609
GO
*** None ***
*** None ***
*** None ***
Sequence
        1470 bases(100 bases per row)
ATGCGGAAGGACGGCGATGTGCTCGCCATGGGCATCGAGGGCAGCGCCAACAAGCTGGCAGTAGGCATTATCCGCTACCGCGTCGATGGAGAGACGGAGA
TCCTGTCCAACCCGCGCAAAACGTATATCACGCCGCCAGGTCAGGGCTTCCTGCCTCGCGAGACGGCTTGGCATCATCAGAACCACGTCGTGGGCATCGT
GCGGGCGTCTCTAGCCGAGGCTGGCGTTTCTCCGAAGCAGCTGGACTGCATCTGTTACACCAAGGGTCCTGGAATGGGCGGTCCGCTGCGTTCCGCTGCT
GTGTGTGCACGCATGCTGTCACTGCTGTGGAACAAGCCATTGGTCGGTGTCAACCACTGTGTCGGACGTACGTTGAGCATGATTGTACTGCTATTATCTC
GACTTTTGGTGCTAATTTTGTGGTTATTGGTGTTATTACCAGACATTGAGATGGGCCGAACGGTGACGAAGGCGGCAGACCCCGTCGTGCTTTACGTCAG
TGGTGGAAACACCCAAGTCATTGCTTACTCAATGCAATGGTGCGGACTGCATTGATACTTGCGTCGTGAGGCGTCTTACTAATTAGCAATTATTCTGTAT
GCTGCACAGCTATCGCATTTTTGGAGAGACGATCGACATCGCGGTCGGAAACTGTCTGGATCGCTTTGCGAGAGTGTTAGAGCTGTCCAATGACCCGAGC
CCCGGATACAACATTGAAGTGCTTGCGAGAGAGTGCGTGGTGTTTGTGCTTAGCTATGAGTGTATCTTTTCTGATCTGTTTCTATGACGCTTCTGCTGTA
TCTTACTGTAGAGGCAAGAAGTTTATTGAGCTGCCGTACATTGTCAAGGGCATGGACGTGTCGTTTTCGGGCATTTCAACTttcatcgagaaggaggcca
agtACGTTTTGGAATATTTGATCCTTTCTACATGTTTCTAATTAGGAGCTTCTTACGCTACTCTAGCGACAAGATCAAGTCGGGGGAATGCACCAAGGCG
GACTTGTGCTATTCGTTGCAAGAGACAATTTTTGCCATGCTGGTGCGTCATTTTACCTATTCACGATAGGATTTCCTTGGATTTTCAATAACGCTGTGAT
GATTCTTTTGTAGGTGGAAATTACCGAGCGTGCTATGGCTCATTGCGGACAGTCGGAGGTGCTTATCGTTGGTGGTGTAGGGTGCAACTTGCGTCTTCAG
GAAATGATGGGGGTTATGGCAAAGGAACGCAATGGTCGTGTCTGCGCTATGGACCATCGTTATTGCATTGACAATGGCGCCATGATTGCTCAAGCTGGAG
TTCTCCAATTCCAGTACGGAGAGGCTACGTCACTGAAGGATGCTACATGCACGCAGAGGTAAGAGacagatttttttttaatttgGTTCCAGCGCTTGCA
ACTTATTGGCGTGATGAAAATGTGCAGGTTCCGCACCGACGAGGTCCCCGTGATTTGGCGTTCCGATTAA