Transcript Name :
Physo_139135
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is a Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Peptidase S1A, chymotrypsin-type1.3PR00722
Peptidase S1A, chymotrypsin-type1.3PR00722
Peptidase S1A, chymotrypsin-type1.3PR00722
Profile scan predictionP-Valprediction_id
Peptidase S126.3PS50240
HmmSmart predictionP-Valprediction_id
Peptidase S14.8SM00020
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5820.67523
*** None ***
*** None ***
*** None ***
TypeScore
nuclear522
GO
Biological ProcessGO IDPrediction Method
serine-type endopeptidase activityGO:0004252IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        1047 bases(100 bases per row)
ATGAAGCTCTTGCAGGTTTGCGCGCTCGCTTCGGCATTGGCGACACTGTCGACGTGTGCGCACGGCTACTCGTTCAATGACTTCAAGGGATCGAACAAAG
AGCAGGAGAACGAGAAGGAGAGCACTGGCCTGACCGCGGACGAGGAGAGCCGCATCATCGGCGGCTTCGACGCCGACATCGACAACTACCCGTACGTCGC
TAGCGTTCGCATTGATGGCGTGACGGTCTGCGCCGCTACGTTGATCGCTCCGCAGTACCTTGTTACGACTGCGCACTGCATCAAGACGGACGAGGTGGAG
ATGACCGCGTCGTTCGACACCGAGTTCAGCTTCGGCACTGATGGCGAGTTGGTGAAGATCGTCAAGGGATTCAAACACCCTCTGTACAACAAGAGGAAGC
ACCTGCACGACGTGGGCCTGCTGAAGCTGGAGAAGCCATCCATGCAGAAGATTGCGGTTCTGCCTGCTGCGGACGGTTCGAACGAGAAGGTCGGCGCCAT
GGCCACCGTTCTTGGTTGGGGTCAGACCAAGGAGAGCTTGAACAGCTTCAAGCTTCAGCAGGCGAAACTTCCAATCATCTCGAACGCGGACTGCAGTAAG
TTCAGCTCGTACAAGACGGGCCTGACGGAGGGCATGATGTGTGCCGGCAACGGCAAAGGCAAGGGTTCGTGCCGCGGTGATGCGGGTGGCCCCCTTATTG
CCAACGACGCTCTTGTGGGCTTCGTGAGCTGGGGTGGTGACAAGTGCGGCAAGGAGCCGGGTGTCTACACCCGCGTGTCGTCCGTGCTGGACTACATTAA
CGAGATTGTTGCCGGTGGAGATGGCAAAAAGTTTGGCTCGAAGACTAGCAAGAATACGGCCACGAAGGGTACGGCAACACCCACCAGCGATGCATCGTCG
GCAGCGCAGAAGACTCCTTCCACGAAGGGACTGACATTCTCGTTTGATGGATCCTCGGCGGAGCAGAAGTCTCCTGCCACGAAGGCCTCGAAATTCACCG
AGGTACCGACGACCGACTCACCGGTCCTACAACAGAAGTCTGCGTAG