Transcript Name :
Physo_138701
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phox homologous domain13.956PS50195
HmmSmart predictionP-Valprediction_id
Phox homologous domain2.8SM00312
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
TypeScore
cytoplasmic609
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        492 bases(100 bases per row)
ATGCGCTACGGTGCGTGCGGCATTGTCGTGCAGTGTGGATTGAGTGCACTGGTTAATAGTCGTGCGGTGGGTGGTTTTCAGGGCCGGATTACTTCACGGT
GGCCATCGTAAAGTACCTCGTCAAGGAGGACGAGTTCGCGCTCTACGAGCTGCAGATCCAGAACGGAAGACGCAATTGGAAGGTGCTGCGTCGCTTCAGC
GAGTTCGACAGGCTGCAAGCGAGGTAGGAGGCTGCCAGGGAGTATTGACCGCGTTGTGACAAGGAGAGCTGACACCTCGCTGTCCAGTGTGCGCTTCAAA
GCAGGTGACCGACTACCAGAGCTGCCGCCCAAGACGTATTGCTGCAGGGACCTGAACCCGGACTTTTTGGCCAGACGCAAGGAGCTGCTGCAGGTCTTTC
TGCACCACATGCTGCAGATCCCCGGTATCGCTGACGACGACCACGTGCGCGAGTTCCTGGGCCTCAAACTGTCCACGGAGCTCTACGTTTGA