Transcript Name :
Physo_136555
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein
This protein is a Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5410.71930
*** None ***
*** None ***
*** None ***
TypeScore
endoplasmic reticulum667
GO
*** None ***
*** None ***
*** None ***
Sequence
        1608 bases(100 bases per row)
ATGCAGCTTCGACTCGGGCTGCCAACACGAGCATGCGCCGCCCTTCTGCTGGGCTCGGTGGTGCTGACCCTGGCGGCGGTGAACGCGCACACGCTGCGCA
GCGAGCCGGCGGCAGTGCCATCACCAGTGGAGGAAGATGCTGTTCCAGCCGACAGTCTATCGCAGCGCGAGACGTTGGGCATGGCGCTGGCGGCACTGGT
CATCTTCGTTGCCGCCGGAGGGGGCACTGGCGGGGGAGGTGTGCTCGACCCCATTTACATCCTAGTGTGCGGACTCAGCGCGAAGGTGCGTCCGAAGGAA
TCGTGGACGTTATGGAGGTCTACCTGTAAAGCTGACTCAGGTTGACGTGGTGTTTTACAGACCGCCATCCCTCTTTCCAGTATCACGATTCTTGGCGGAG
GTTGGTGCTCGGTGCTTACCTGTTGAACGATCTCGCTCAGTTGCTCACTCGCGTCATTTTCGTCCTCTCAGCAATCGGCAACTTTTTGATGAACGTGCGG
CGCACGCGGGACAACTCGAAGAAGCCGCTCATCGACTGGGATGCCATCCTGGTGATGCAGCCACTACTCCTGTGTACGTTATCACTATTGGTCGGAAATT
ATATATCTTACTGTGTACTCACGTGTTGGTGTTGTTTACAGTGGGAGCGACCTGTGGCACCGTCCTCAACACGCTCATGCCCACGTGGCTCCTCTGCGTG
CTGCTGGTGCTGGTCCTTAGTGTCACCGGCACTCGCACCTTGCAAAAAGCTATCCGCGCGCGTCAAAAAGAGCGGTGGCAGTGTGGCGTCTCACCCGAGT
CGACATCTCTCCTTGGCGTTGATTCCGCTTCAACCGACGGTACCAAGGCCCATGCTGGAGAACCGCAGCTTCGCGCCGATGTGCCGTGGCGGAAAATCGC
GACTCTTTTCGGTCTATTTGTCGTCGTCGCCGGGATGAGACTTGTCCGCGGAGGGCAAAACTTTGACAGTCCGATTGGCCTCGATTCATCATCAGCCTTG
TACCCCGTGCTCGTAGCGTTACCCTACGTGGTTCTCGTTGGTGTCGGCTACTTCTCCCTCAAGAACTTGGGAGCCGTTTACGAGAAGCAGCAGAGCCCTG
CATATGAGCTTGAAGCCCACGAAATTCAGTGGACGTCGTCATCGATCAAGTTCTTTCCCGTTTTCTCGTTCGCAGCTGGAACAGTCTCCGGCATGTTTGG
CATCGGCGGAGGCATCATCAATGCGCCGCTGCTGCTTGAGGTGGGCGTCGACCCTTCGGCCGCTTCGGCCATGACTGCGGCGACCGTGCTCTTCTCGAGT
GGAAGTAAGTCTCGCGTTATTTTCTGTCTGTGCTCTGCTGCTAGCTGCTGCTTTGAGGGCTAACTTGTTCTGCAATGTCTTCTCCAGTGTCGTCGTTCAA
CTATCTTATGTTGGGAAAGTTGGACCTGGACCTCGCACGACTCATGCTGCCCATGGGGTTCCTCACTACGTACATTGGACACATTTGTCTGCTAAAGGTT
GTTCGCCGATTCCAGTGTCCAAGCTTAATTGTCTTCTCCATGGCCGCGATCGTTCTGATCAGTGCCGTCGCCATGAGCGTCGAATGCGTCCGGGCGCTCC
TGTCGTGA