Transcript Name :
Physo_136309
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase8.609PS50878
Integrase, catalytic core17.539PS50994
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
TypeScore
cytoplasmic565
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        2812 bases(100 bases per row)
GAATGGTGTATGAGAACCCCCAAAGTCGCTGGGCGAGTCCCGTCTTGCCCGTCAAGAAGTCAGCTGATCTCATGGACTTGCGCCAAACGACGGACTATCG
ACTGGCTAATGCTGAGACTGAAGTGATGGCCGCTGTCATGCCGATACTTTCGGTAATCTTGGAGAATGCACGTGGTAAAAAACACTTTGCACTCTTTGAC
TTTCTTAAGGGCTTCTGGCAATTGCCCCTCGCTGAGATGTGCCAGGAGTTCCTCTCCTACATGACAGACGAGAAATTTTTTACACCGAGGCGAGTTCCAC
AAAGCTGCAGCGACGCAACCATCTTTTTCCAGAAAACTATGGAGACTTGTTTCGCGAGCCTGCTCTCCTGATCTGGATCGACGATTTGTTGCTTTTCGCC
GACGACATTGACAGCTATCTGGACAAGCTGGCCGAGGGGTTTTCGCTGCTGAACCAATTTAGGCTCAAGCTCAGCGCCAAGAAGTGCAGCCGGTACCGGT
CTGACGTGAAGTGGCGCGGCAGGTTGATCAATCACCAGGGTGTGCGGCATGATCCAACCCGTATCGACACGCTGCGAGCGATGCCGTACCCCGAGACGGC
TGGTGAACTTCAGCAGTTCGTGTGTGCTATCAACTGGATGAGGGAGTCGATTGTTGACTTCGCCAGACAGGTAGCGCCCCTGCAGAAACGCCTCGACGCA
GCGCTCACCACCACGAGGCGAACTCGACGTGCCGCTGCTAGTATTGAGCTGGAGCTGACTGTGGAGGAGCGCCAAGCATTCGACAATATGAAGGAGAAGT
TAGCGACGGCGGCTACTCTTGATTTTCCTGTCGACACAGCCACGACGTGTTTATTCACGGACGCGTCCGACGTCGGCTGTTCGCTCATTGTAACTCAAGT
CGTGAACTTTGACCCAAGGGTGCCTGCTACGGACCAGCAGCATCGTCACCTGTACTGCATGAGCGGCACCTTCAGTGGCAGCCAATTGAACTGGACCGTG
ATCGAGAAGGAGGCGTTCCCGATCGTCACGGCCTGTGACAAACTGGACTACTTGTTGCTGAGGCCCAAGCCATTTCGCATGTATTGCGATCACAGGAACC
TGATCCATGTGTTTGCCCCGCATCAGAGTGTCAAAAAGCACATCAAGGGCAAGTTGCTGCGCTGGTCGACGAAGCTGGTCAATTTCCGCTACGTAGTGGA
GCACGTTCCTGGTCCGTCCAATGTCTGGGCGGATATGATCTCACGCTGGGCTGGAAATCACACTCCTACTGTTCGTGTCAAGCGTTTGAAAGCTGTGCGC
AGTCAATCGGAGCCTGCGGCATCGGAGACACGAAGCCCGGCACCTCTGCGCCCCCTTGATGCTGAGGATTTTGTCTGGCCTACTCTAGTGGAGCTGTTTG
ACACCCAGTCCGAGTTTGAAGCGCCCGTGGACGCCGAACGGAACGCCGACGGACTACTCATGATTGATGACAAGATTTGGGTACCTTACGAGGCCAAGGA
GCTCATTCAGCGGCTGTGCATCGTGGTACACTGTGGCGCCCAAGGACATCGTGGGCAACACGCCATGGTCGCACACTTGCGCCGTCTGTTTGCTATCGAG
CACCTCTCTGCGGTGGTTTCTTCGTTTGTTGGCCAGTGTCTGCTGTGTCTGCATTCGCGAGGGGGGAAGATTATCCCCAGGCCGTGGGGCGAGACGATCG
AGTACAGCTCTCGTAATGAAGTCCTCCACTTTGACTTCCTCTACATGGGCGAGTCTTATGGCCAGAGCAAGTACCTGTTTGTTCACAAGGATCACGCGAC
CCATTACTGCGAGCGGGTTGTGGCCGACACAGCCGACAGCAGCGTGGTGACTGAAGCCCTGCTGGACTGGCACTTTCGATTTGGTATCCCGCCTGAATGG
GTATCAGATAATGACACGCACGTCAAGAATGAAGTGGTTGCGGAGTTGTGTCGTCGCTTGAAATCCAAGCAATCGTTCACGCTAGCTTACTGTCCCTGGA
TAAATGGCTCAGTCGAACGGGCCAACCGAGACATACTGCATGTCATGCGAGCGATGATCCTGGAGTACAAGATAAGCTACAAGGATTGGGTGTACATGGT
CCCCATGGTCCAGTCAAGTCTCAACCACACGGCTGTCTCATCACTGGGGAACCGTGCGCCGATGGAGCTGTTCACGGGCCTGCAGTGCCCCACACCACTC
AAGGAGTTCTACCTGCCGGAGACGGGTGAGCTGCAAACTGTTCCTGACAGTGATGCGATCGAGGCGTTCCTCGAGAAGCTGCGTGGCAGCATACACGACA
TGCACAAGGACGTCGAAGACCAGAGGGAGAAGCAACGCCTGCTGAAGAAGAAGTGCCAGCGCGGTGAAAACCTCGTGAATTTTGCAGTGGGTGACTTTGT
TTTAAGGTCTCGCGTCGACGAGAAGCACGGGAACAAGCTTCAGGTGACCTGGATTGGCCCCTACAGAGTGGTGCGAGCTGATGCACACTCGTTTCGTGTA
CAGGACTTGGTTACAGGTGACGAACAGGACGTTCATGCCTCACGCTTGAAGATGTACGCGGATGACAGCCTCGAAGTGACAGAGGAACTGCTAGATCATG
TTGCATCTCAAGGTATCCTGCTTGCTGTGGGTAGTCTCAAGGATCACCGTTGGAACGAAGCCACCAGTGACTACGAGTTACCCGTCAGCTGGAAGGGCTT
ACAGCCCATCGAGGACTCCTACGATCCCATGCTGGACCTCGCCAAGGAGATCAAGGTATTGGTGGGCAAGTATGTGGACACGGCAGGCGACCAGGATCTG
AGCAACTACTGA