Transcript Name :
Physo_135962
Orientation:
(+)
Number of Exons:
9
Description :
reverse transcriptase
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Integrase, catalytic core10.767PS50994
Chromo domain/shadow11.707PS50013
HmmSmart predictionP-Valprediction_id
Chromo domain/shadow4.5SM00298
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
DNA integrationGO:0015074IEA
*** None ***
*** None ***
Sequence
        9832 bases(100 bases per row)
ATGTCGACTGCTGCTGATTCGAAGGAAACCAAGACTGGAGGTGAGAAGAGCGAGTCTTCGCTTCGGCGAAGTTTGAGAGTGGCTGGATTGCCAGCCGAGG
TGGTGCCGACGGAGTCTGGGACGCCCAGGGCGAGAAGATCGACTGCGGGAGCCCGGACGCCCAGTGCTGAGGGAGAAGCTGCGTCGTCAGGCGAGGCTGC
GCCAAGCGCTGAGCCGGAGGTGCCACCAACGACGGAAACTGCTGTGCCGCCGCCATGTTCGCCCGAGAGGAAGAAGTCTGAGAATGAACAAGGTGGCGGA
GCGGTTGCTCAGCCGAGCGCTCGTGTTGGTGAAAGTCTGAGCCTGAGAGAGCCTGCTGTGAGTCGAGCGTTGACGCCGCGCAGGACTTCTGAGACTGCGA
CTGCAACTTCTCAGCCGCAAGGTGTTAAGCCGGAGCCAACTGCTGCGGATCTCCGCAGTGGCCAAGCCGAGGGTGGTGCACTGAGCGTGCTGGGAAGCCG
AGCGATGCAGCTGCGAGATCAAGGTGCTGCTGGGACTGGGACAGGCCCGGTCCAGTTCAGCTTTATTCCGGAGCTGGATACGTCGGAGCGTCAACTGGTG
GCGGAGCCTGGTCAAGTTCACTCTGGCCGGACCAACGCCCCTACCAGAGGCTGAGAGAAGTCCCCGAAGGAGCGGAAGCTGACAGCCGCGCCTTGGCCCA
GCTGTCCGAGCTGTCCGAGGTTGAGATGCTCGCGTACGGCCGAACTCAGTTCGAGATGTGGATGTCTGTGCCTGCTGGAGTCGTGCACCCGGTGGATGTG
GCCTATTCGCCATGTCATGGAGGCTGCGATCTCTGGGGTTTCATCCGAGCGGCTGGAGCTACGGCCAGACACTTGATGTCTGTGACTCGGTCGCCCGCTG
CGAGATGGCTGAACGTGTTCCACGCTGAACGTCGACGGAGCCCTGTCGTCTCCGACCTGAAGGCAGTGCGCGTGGCACTGAGACTGATGCCGCCCATTGC
ATGCGTCGCTCTGTTGCAGACGATGCTGCATGAAGCTGGCTATGAGTTCCTGAACCAAGTCTCAGTGTGGCACACGCTGTCTGAAGTCGCCGGAGTCCCG
GATTCGCAGATCCGGTTTGAGATCTAGCGCATCGCCCGATTCCTCGGAGCTGAGCTCAGAGCCTGGAAGGCTGCGGTCGGTTCAACCCCATACTACGTGA
GGCCGACCTCAGACCCTCCGCTGATGGCCGCTCAAGCTGCCGAGACCCAAGTTGGATTCCCTCTGGACAAGGATGGAGACGCGATCATGGATGAGGATAC
TCAGCTGTTCCTGGGACCTGAAGTCGTGATGCGCCTTCAGCTCACTGGTCTCAGACCTCTGAGTCCGACCTCAAGTGTCGAAGGCGAGCCGTCTCGAAAG
CGTGCATTGCTGACGAGGTCTTCTGCTAGTGGCTCAATCCTGAGCTACCACGAGTCTGGCGAAGCTCCTGCTGAGACTGCGCTCGGATTCCGAAATGACC
AAGTGCCCAGCATGGTTGGTGCAAGCTCTGGTTCCGACATGTCTTTGATGGTCACGGATGAAGGGGGAAACCTGTTTGGATTAAGTTCCTCTGGTTCCTC
TCTGATGTCTATGACTGACTACATGGTTGGGACTGGGACGCACATGCCCATGTCGACGGCGACGGTGATGCGAGGCTCAGCTACGACGATGTCCCGCGGT
TCATTCCCGGGAATGACGATCTCGGTCACGCCTCAGCTTACTCAGGCTGGTCCCGTACCGGCCAGAGCTGAGCAGGGGCTGTATCGACCTGAGCATCCAG
CCCAGATACCGCTGCCCGGCAGTCCTGAGTCCAAGCGTTCAGCCCCGAAACAAGCTGAGACCCGACAAGTGCGGCCCACGGGATTCCGGTTCACACATCC
ATCAGTAATCGGTTCCGCTGGGACGACGACTTCGGATGACTTGCCCTCAGTCGAGCGAGACTACCGGCGAGCCCTTCAACAGAGTGAAGCTACTGCCTGG
GCCCGCCTTGATGCAGAGCAGAACCAACGCCGAGCCCTTGAAGCACGATTGAGCGCCGCTCTGACCGACAACCAGGCGGAGCGAGCCCGACTGCAGGAGG
AGTACCGGAAACTTCAAGCGACCAACGTTCGGATGTCTGAGGCCCAACAACAGGCTAAGACGGAGCAGCAGAAGCAGCTTGAAGCCTTGGAGAAGCTGGA
CCAGCGCCGCGCCGCCGAAGAAGCTGATAAGCACAAGGCGGCCGAGGTTCGAGCTCAGCAACTGCTCCAAGTCCAGAAGGCGCTCCAAGAGGCTGAGGTT
AGGGCTATGCAAGCTGAACAGCGGAAGGCGCAGGAAGAACGAGCTGCCGAGATCAAGACCGAGCACGAGCTGGAACTGCTAAGGCTGAAAGAGAAGCATG
CCCAAGCAGAGGCAGAGCACGAGCGGACCATGCAGGAGCAGGAGGAGAAGACCCGCCAGCTCCTTGCAGCCCAGGAGCAGCCCAGTCTATATCCTGGCCC
CGCCGCTTCGACTGCTGGACGTGTGCCAATGCCAGCGGACCCACCGGTCCCAGCACCTGTCGTGTCGGCTCGATCGCCGACCGATCCGGTCCTGGCGCAG
TTAGCCCAGCTCACGAGCGTGATGCAGCAGTTAGTCCAGGCCAACCAAGTCAAGCCTGAGGTGGCTGGTATGAGCCGCGGTGCTGGCAAGACCCAAGGTT
CGGCCAAGCGTGCTGAGACCAAGTCTAAGCCTCGTGCATCAAGCGCGACGTCTGGCGCGAAGGGCAAGGCTCGGGCGACCAAGCCCGGCAGGCCCGGAGG
CTCGGACGAGGACGACTCTGACTCAGATGACTCAAGCTCGAGTGACTCGTCGCAAGATGAGCTCGAAGGACAGTTTGGTGCTGTGGCGCAGCCCAAGGGA
ACTGATACCAGTTCCGGAACTCGTGTGGTCGTTCAAGCGATGATTCCCCATGATGCTTTGGAGAAGTTCGACGAGAAGGGACCGCTGGAGGACCGAGTCA
ACTGGTGGGAGAGGTTCATGTACTACGCTACGATGGCCCCCTGGGACGAGAAGACCCGGGTGGTCCACCTACGCGTGAGACTCACTGGTTCCCTCAAGGA
TTGGTGCGCTCAGCTACCGGATGACGTTCGCTCGGACTGGAAGAAGTTGTCTCACGTCTTCAAGAAGGAATGGTGCCGTACGCTGAGCTCCAAGGCTGAG
CGGTACTACTCGATGGAGATGAAGGACTCCGATACACCTCGGATGTTCTTCTACCGTCTGAACCATGCCGCCAAGAAGGCTGGGATCCCGTATCTGAGAC
CGACCGTCGATCGAGAGGCTCACATCCGACGTTTTATCAAGGCTTTGACCGACTCAAGGCTGAGGACTACTCTTCAGGGACAGCGTTTCGATACTTTGGA
TGAATTGGAGAAAATCCTGAAGAGGATCGAGGCTCTCCGCCAAGACGAGGGCTATGAGCAGAAGCGGCACCCAGCGCAAGGACTTCAGTTTGGACGTTTC
AAACCTCCACAGCGTCGAGCTGAGGGACGTGCATTCAAGGCGGAAGGTGTGGAAGTTGACCCAAGTCTGGGACGACATGCACATTTCCAGGATGACTACG
ACCTGAAGTACGAGGCTGATTCTGAAGAAGATGTGGACCGCTCAGCTGAGCGAACCGTGTCTTCGACTGTCCCCGCGCCAGCTCCTGCTGCTGCAAGCTC
AGCCCAGGCTGAGCCCAGTCGCTCTACCTCCCTGACCGATGAAGAAATTTGCCGAGTCGCTGAGAGATTGGCCTGGAAGCCGATCGCTCAGCGCTATGAC
CGTGGAGGAGACCAGCACCCAGAGCAGAAATGTGACGAATGTGGCAGTCGTAACCACCCGACTGACAAGTGCTGGAGCCGACTTATCTGTGGGCGATGCC
ACGATGAGGGCCACCCGACCCAATTCTGTAGGCGTCAGCCGTGTTCGAAGTGTGGCGAATACCATCGCCGGGGTTTGTGCGATATGTGGTCGGCACTCAA
GGCGGTACGCGAAGCAATCCGTACCGGAGGCTCGGTCGAGGGCCTCGCTCCTGAGGTAATCCAAGCTCTGTTCGATAGCCCAGAGCTCCGAGAGAAGTCG
TTAAACCACTAGGCTCGCTGGTTGGGAGACCAGTGCGTGACGAGCCTAGATCCCAAGCGCTCTGTGCCTTTGCATATGTGGGCCCAGCCCTTCCATGTTG
GCGCAGAGATAACCCCGAATGTACATCTTCTTATCATGAAGCTGGTGTTTACACTTTCGATACTGACCTCAACACGCTGGACCCGGAGGATAAAATGGAG
AACCATCTTGAGTTTGCTCTGACTCCGGGCGAGAAGTATGGTTGGTGGAGTGAACACACGCTGACTGGCGAGAAGCGGAAGATGGCGATGGTGCACGGAG
CAATCTTCCATCACCAACCGCAGATACTAGTGGATACTGGAGCTACGACAAGCATTTTGGGCTTGGATCTTGCACGCAGATTGAAGCTCAAGCTACGCCG
TGGTTTTAGGCTCAGAGTAACTGGAATGGGAGATGCTCCGACCTACATTACCGCCCAAGCTAAGATCAAGCTGACGCTGGGAGTGCGCGTGGTGTACGTT
ATGGATGTCTGGGTTGGCAACATTGATTGTCTTCTCGGAGTGGACTTTATGGTGGCAGCTGGAGTGTGGCTCTGCGCTCGTGAAGGCGTTGTGAGGCTGC
CGGACGAAGAATCTCTGTTGTTGGTTGGAGGACCTGAGATCGATCATGACGGGCTGGAAGTCAGCGTCTGGTTGAATGAGACTGCTTACCACTACCCTGG
GCAATCTGTGATAGTCCCGGTCAAGTATCACCAAGCAGAGAAGGTAATTCCCTGGGCTGGGCTCGGTGATCAGTGGGTTACGCAGTTCATCTATGGACCT
GGGCGGAGGCCGAAGGCTGTCAAAGTGGTCAACATCTCAGAGCGAGAAGTCATGATCCGCCAGCGCACTGTGGTTGCTTGCCTTGTGGAGAAGGGTTACC
TGCCCAACGGGAAGCGGTTCGCGCGACCTTACTCGTGGAAGTACAGCGAGTGGGCTCAGCTCATCTACGAAGCCGAGCCCTCTCCGGACTCTCTGAGACG
AGAAGAGGAAGCGGCTCGGCTAGCTGAGATCAATGCCCCACCCGCTGTGGAGAGGCCAGACTATAAGCGACCCATGAAGCTGCTGCTGCTGCTGCTGAAG
CAGTCTGATGACCCGAAGGAAGACCGAGCCAACATGAAGCAGCGGAGAGCTGAGGCGTACGCCACCAATACGGTATCGCCTGAGACCGCTCAAGTCAAGA
TGGCCCGGACACATCTGGGACGTCCTGCCTCATGGAAGCCGCCGCTGCCGCGATCGCCTCACCCGGATGATGTGCAGTCAGGGACGAACCAAGGAAGCAC
ATCGGAGGGAGCTGACACTCAGTCTGCGACTGAGCCAAGTTCCTCGGAGTCAAGCTCAGCTCAAACCTCTCCTGCTGGAGGTGGTGTGAATGCCCAAGAA
GCTCGGAACGAGCTGGAGCGAGTGCTCAGGACTGAGCCGACCGACTTCGTGTCTGATCCAATTGCTCATCTTCAGGAAACGTATGCTCGTTGTCTCAGAG
GTGAGATCAGTGAGGACGCCGATGAAACTACGGTGTACTTCTATGAAGGCACGGAATTGCTGAATGACCTCCGGGACCAGCTCGCTGCTCTTCCGGAGTT
GAAGGATCCCAGTCCAAATGCGGACCTCTCAACGGCTAACGTGGGAGAACCAGGCGTTACGACTCCAGAAATGGACGCTCAAGTGCGGACGATTCTGGAA
AGACATCATGCCAGTTTTCTCGGGGACGGGAATGCAGTACCGGCCCCTGCCCGTGGAGTTGTCTGTGACTTGGATGTTGGGGACGCGAAGCCCATCGCTC
AGAGGTCTCGGCAGGTCCCGACACACTTGCTCGACAAGGTAATTGCTCTGATCAAGAAGTTGCTGGAGACTGGGCTCATCGAGTATTCGCACTCAGACTG
GGCCTCGCCAATTGTGATTGTGATGAAGAAGAACGGTGTGGACATCAGGCTGTGCATCGACTATCGACTGGTCAACCAACTGATCAAGCTCTCACACTAC
CCTCTGCCCTTGATTGACGACCTGTTGATCGGGTTTGAGGAAGCGATGTGGTTCCTGAGCTTGGACATGGCCAACGGGTTCTGGGCGGTGCCGATGACAC
TCCGGGCTAAGCTGATCTCTTCATGTGCCCTTTGGGGCACTTCCAGTGGAAGCGCATGCCGTTTGGTCTCAAGAAAGCCCCGCTGATCTACCAGCAGATG
CTCGATAACTGTCTGTGGGGCTTCGTGCGACTTCCGCCCTGCGAGGAGGTCCGAGTTGATCCCTGGATGTGCTGGATTTCCTAGGAATCGAGGTGGACGA
CTCCGCTAAGGAGGAAGAAATCCCGCCTCTGTCTGAGGAGAATACCGTGTCCCGGCGAAATATTCCGGCCCCGCCTCAGCTGAGTCCTGTTCTGGGGCGG
AGCTCCTACATCGATGACATCGCGTATGGAGCAGAGACCTGGGACCAGATGTGCGAAGTCTTGGACCGGTTGCTTTATCGACTGAGGTACGGGGGGATTT
CGGTAGGCTTGCCCAAGAGCGAGTTTGGCAAGAAGTCTATCTCCTACCTCTCGCACGAGATTGGAGCTGAGGGAATCCGAGCCAAGCCGAAGATCGCCAA
GGGAGTCAAGGACTTGCCGTTCCCGTCGACGCTGAAAGGAGTGCAGTCATTCCTGGGGAGTCTCAATTACTACAACAAGTTTATTGAGGACCTCCCGGTT
GTAGCGTCTGTGCTCTACGAGTTGACGGATGAGCAGATTCAAGCTGGACGTGATCTCGGCCGAGCTGAGGAGGCGTTTGAAATCCTGAAGCAGAACATTG
TCTCTACCCCGCTGCTCAGACACCCGGACAGGGAGAAGCCGTTCGTGATTATTCTACACGCTAATCCCTGGGCAGTCTGTGCGGTGCTGGGCCAAGAGTA
TGACGGAGTAATTTTCCCGGTGCGATACACTGGGAGGGCACTGCATGATCAGGAGCTCAGATACCACCCGGCTGAGAAGGAAGTCGTAGCGTTGCTCCGG
GTTCTCAGAGTCTTCTATTCGATGCTGAGCGGATGTAAGCTGCTGAAGGTCTACACCCGGTACTCTGTTCTGAAGTGTTTGTTCAAGTCTCGATCGCTGG
GGGGACGTTGTGAGCAGTGGGCTGCACGGCTGTCGCCCTGGCCTTTGGAGGTTCAAAAGGTCGAACGTGATGAAGATGGTTTGGCCGCGGTCATGGGAGT
TGGGATCACCCCCCGAGACCAGTTGGACAGGATCGCTGAGAACCTTATCCCAGATAAGGGACGAGTTGTCCGAGCCCCACCGATCAGCCTGGAGATGCTG
GAGGCGGGCTACGAGGGGTGGCTGCTCAGTTTCGATGGAGCTGCCAAACGCTCAGACCGCTCTGGTGCTTCTGGTTGCATTCTGTGGAAGCTCCCGTCCT
GGGACGTGGTCGAAGCTCGAGGTTTCCACTTTGAAGGCATTACGGTGAATGATGCTGAGTACCATGGTTTGCTCGAAGGTATTCGCATGGCAAAAGCTCG
TGGCATCTCAGACCTTGTGGTGGTCGGTGACTCTCGGATTGTTATTCAGCAAGCTCAGGGTTTGATCCAGTGTCTGAGCCCAGGACTGCAAGTGCTGCTG
GCTGAGTTCGAGACGCTTCGCCCAGAGTTCCAGCGATTGCGCTTGGTGCATGTGAAGCGTGAGTATAACGCAGCTGCGGACTATCTCACGTCGAATACTC
TGGTCATTCAAGGTCCCGTCGCTATTGAAGACCCGGTTGAACTGGTTCAGCTCAAGCAGCTGAATCGGATCCCGGAGAAGCTGATCAAGGTGAATGAGGC
TGAGTCTGCTGAGCCTGAGACGGAGCAACCTGACACTCAAGCTGATGTAGAAGTGGTGGCTAAGCCAATTCCACTGGAAGATGCTGCCAAGCCCCTGTTG
CCCAGCGCTAAGATCTTCGTGGTGACTAGGAACCAAGCTCGGGCCAGGGACGCTGAGACTACAGCAACCAGGGGCGACTCCGACCAAGGTATCGATCCTG
ACCAGAATGCTGAGCCCCCCGCTGAGCAAGCTCCAGTGTACTCACCTGAAGCAGCAACTCCTGCTGCGTCAATCGTTGAACGATGGAGACGGATCCTAGT
TCTGCAAGAGGCTGAGCCTTGGACGAAGAAGCTCAAGGATTATCTGAATGGAGACTTGGGGAACCTCTCCGCTACTGAAGCTGAAGATGTGGTCAAGATG
ATGGATCAGTTCACCCTTGATTCGAGAGGAGTCCTGTACTATCTGAGTCGAGCTACTCCGGTAAGGCCTAGAGACGCAGTTGGGAATCTGAGATTGGTTG
TGCCAACGGCGCTGAGAGATGACTTGCTTCAGCTCAGCCATGAGGAGTTCCAAGGTGGTCATTAAGGGATCACTAGGACCTTCGAACGACTGCGCAGGGA
GTACTACTGGCCGAGGATGTACGCGGATCTGGAACGCTATGTGAAGGAATGTGTGGATTGTGTCACTGCCAAGGGAGCTCCGCCCAACCCTGGGCCGTCG
CCGGGAAACATTTTGGCGACTAAGCCCTTTGAGGTGGTCTCTATGGACTTCGTTACGTATCTACCCAAGTCTGACCGTGGAAATGTGTTCCTGCTCCTGT
TCCAGTGCGCATTCTCAGGCATCATCATGTGCAAGCCGATGAGTCTAACCACAGCTCAAGATGTCGCTGAGGCCTACATGGAGTGTGTGTCCCAGAGGTT
TGGTGCGAGCTCTCTGCTCCGCCATGACCGTGATCCACGTTTCATGAGCGAGGTGTTCGCCAGGTTCCGCGAGATGCTGGGAAGTCGGCAGCGTGCGACT
CTGGCGTACAGACCCCAGGCAAATGGCCAGCAAGAGCGATCAGTGCAAACAGTGGTCCGAGCCATCCGAGCGTACGTCGCTGAGCCAGATCAGAGCGACT
GGGACGACCAGGTGGAGAAGTTGATGTGGGCTCTGAACACGACTTTGACGCCACCCGTCTCGACACGCCGTTCTACCTGGTTCACGGCTGGGACCCTCAT
AGCACTGTTTCGGCCATGCTGGGGCCATCTCCGACGGGCTTGGATCAGAGGACTGCTTATGAGTGGCGTCGCAAGACTCAGCGCGAGTACGAGTACGCTC
AGGCCTGGGCTAAGGATTTACAAGCTGAGGCCAAGGTAAAACGCTCGGCTGCTCAGACAAAAATCTGGGCTGAGTTGTCTGAAAGACTCAAGAAAGGTTT
CGAAGTTGGTGATGCCGTGTGGCTATACCTGGCTCGAGTGCAACCTGGGCTCACGAAGAAGTTCGCTCACCTCTGGCACGGTCCGTTCCGGATTCTGGAG
ACCTCAGATGACTTCCGATGCAAGCTGAAGATCGAAGGAACTGGGTACAAGTTGTATCCTTGGGTCCACATAAGTCGACTCAAGCCGCGTGCCCTGTTCC
CGGAACGACCTACAGTTGAGGTTGAAGTCGCTGAGGATGATGATCTAGACGCAGCTCTGTTGCCTGAGGATGCTGAAGAACCCGATGAAGCTCAGAATGT
GTACGAACTGGAGGCCATCCAGGATGTACGCTGGGTTAAGCGGACCCGAACTTCACGGAGAGTCCGAGAGTACTTGGTCAAGTGGAAGGGGTATCCTGAC
ACTGAGTGGCTTCCCATGTCTCAGCTAAGTTGTGGAGCTTTGCTGTATGAGTTCAACAAGAGCGCCAAGGCGAAAGCACGGTTCCAAGCAATGCAAGCTG
GGGATGAACCTCCTGAGCCCGATGCTCAATAG