Transcript Name :
Physo_134814
Orientation:
(+)
Number of Exons:
4
Description :
FAT domain-containing protein / phosphatidylinositol 3-and 4-kinase family protein (ISS)
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1622 bases(100 bases per row)
ATGAACGTGGAGGTGGTGCGCCAGAAGCTGGTGGACGGCGAGCCGGACGCCGTGCTGAAGGAGCTGGTGGACCTGTACCGCCGCGCCGAGATCCTGCACA
CACCGCAGCTCGGCCGCATCCTTGAGGCGCTCTTCCCGGTCTGGAAGGGGTTGCTGCAGACCAAGCTGCAGCCGCAGCTGCGCTCCACGACGCAGAACCG
CTGCCGAAAGGTGCTCCTGCAGATCCTGAATAGGATGCCGAGTAATGAAGCGCTGCGGCCGTATGTGGCGCAGCTGCTCCAGCTGCTGATGGAGGTCCTG
CAGAAAGACAACGAGGACAACGCGCTGATCGCGCTCAAGACACTGTTCGACCTGCACCGCAACTACCGACCGGGACTCCGCAATGAAGTGCAGCCGTTTC
TGGAGCTGGTGCAACTCATGTACAAGAATCTGCAGACGACGATGAAGAAGCAGTTCAGTGGACCGCCAGAGACGCACAAGTCCAGCTCCGTGTCGGCGGC
AACGACGCCCACTGCCGCTAAAGCTGCAGCGTCTTCAGCTGCTGCTGCAGAGGAAACAAAGGAATCTACTGCAGCTGAAAAGGAATCGGCCAGTACTGCG
AGTACTTCGGCGGGATCAACACAAGCAGGGGCGTCAGCACCCCAGGCAGCAACGAGTAGCAGCGCTGGCGAGACGGCTGCAACTGCAGCATCTTCTTCTA
CAGCAGTACCAGAAAATAGTGGTGCAAGTGCCGCGGCTACAGCAGCTTCTGGTAGTGAATCAGCCACCGATGAGCCTATCTGCAGCAATTTGGAGTCGTT
CAAGACAATTTCGGAGTTGCCGTTGATCATCATGCTGCTCTTCCAGTGCTATCCGAGCTACATCGAGAGCTACATTCCCGTTTTGGTACCGCTGATGATG
TCGGCGCTGGCATTGCGTGCGCCGGATACGGCGGCAACGTCACATCCGTCTCGTTATTTGGATTTCTTGGATTGTCAAGTGAAGACGCTGTCATTTGTAA
CGTACTTGCTGCGTGGGTGCGCCAATCTGATGCGTCCATTTCAAGATGCTATCTGTGAGAACACAGTAAAGCTGCTCGTGGCTTGTCCCAAGGACGCCTT
CGTGCTACGCAAGGACATCTTTGTGGCAGCAAGACACATCATCTCGACGGACTTTCGGAGAGGGTTTTATCCGCAGCTAGAACTACTCATGAACGATGAC
GTGTTGGTGGGCAAGGGACGTTGTAGCTTCTACCAGATCCGGCCTTTGGCGTATTCAACTTTGGCAGACATGATCCATCATGTTCGGGATATGCTAACTC
TGGCTCAGGTGAGCACAATCGTGGATTTCTACGGCAAGCGTATCCATGACCCAACGCTGCCAATCTCTATCCAAACGACCAGCATTCGGTTGCTTCTCAA
TCTCGTCGACATCAGTGCTAAGAATGAGGATACGGACGCATGGAAAGGTCGTAACATTCTCTCGCGCATTCTGCTCATCATTTCTGGGAAGTTCGGCACA
ACGCTGGAAAATTTGCCTATGGCTCTTGCAACTACTCTTCGCAGTAAGTCTAGCGGTGATCGAGGTGATCTACTGGAAGGAGGTGCTATGGATAAAATCA
AGCAGTCCAGCCTGCTTCCTAA