Transcript Name :
Physo_134104
Orientation:
(-)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Importin-beta, N-terminal domain21.585PS50166
HmmSmart predictionP-Valprediction_id
Importin-beta, N-terminal domain5.3SM00913
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
TypeScore
cytoplasmic348
GO
Biological ProcessGO IDPrediction Method
intracellular protein transportGO:0006886IEA
*** None ***
*** None ***
Sequence
        3099 bases(100 bases per row)
ATGGCGGAGCCCAACATGCCCATGCTGCGCCAGTCGCTGGAGGGGACGCTGTCGCCCTTCGCGGAGACCCGCAAGGGCGCCGAGGCGTACCTGAACACGC
TGTCGGCGCAGCCCAACTACGTGCTGCTGCTGCTGCAGGTGCTGGAGAGCGCGGCCGAGAAGCAGGAGGTGCGCCTGGCGGCCGCGCTGCTCTTCAAGAA
CTTCATCAAGCACAACTGGGACCCGGAGAAGCAGGGCTGCGTGCCGCAGAACGAGAAGAACCTGGTCAAGCAGCACCTGGTGGAGCTCATGTGCCGCATG
CCCGAGACGCTGCAGAAGCAGCTCATCGAGGCGCTCACCACCATCGGCGAGTACGACTTCCCGGCCCAGTGGCCCGACCTGCTGGCCCAGCTGGTGCAGA
AGCTGCAGGCCGAGCAGGACTGGCAGGTCAAGAACGGCGTGCTCATGACGGCCAACACCATCTTCAAGCGCTTCCGCAACGTCTTCAAGTCCGACGACCT
GTTCCGCGAGCTCAAGCACTGTCTCGAGGCCTTCCAGGAGCCGCTGCTCGTCTTCTTCAAGGAGACGGGCGTCGCGCTGCGTGCGCCGGGAGTTGCGACC
GAGCAGCAGGCGCTCATGATGGCGGCGCTGCGGTACATGAGCCGCATCTTCTACTCGCTCAACTGGCAGGACCTGCCTGAGTACTTCGAGGACCACATCT
CCGAGTGGATGGGCGAGTTCTTGAGCTACTTCAGCTACGAGAACCCGGCGCTGGTGGACACGGACAATGAGGACGAGCCCGGTCCGATCGACAGGCTCCT
GGTGGCGATCGTTGAGAACATTAACCTGTATGCCGAGAAGTACGACGAGGAGTTCAAGCCCTTCTTGCAGAAGTTTACCGAGGTGATTTGGAACCTTCTG
GCTAACCGCATCACGCTCTTCCCCAAGCACGACGAGCCGGCCGCCAAATGCATGAAGTTCCTGACGTCGGTGGCCTCGCGTTCGTTCCACCGCGCGCTGT
TTGAGTCGCCGCAGGTGCTCTCGGAGCTGTGCGGAATCGTGGTCAAGAACCTGCAGCTGCGGTCGTCGGATGAGGAGCTATTCGAGGACAACCCAATGGA
CTACATCCGCCGCGATATTGAGGGCTCTGACGGTGACAGCCGCCGCAGCGCCGCGCGCGACTTGGTGCGTGGCCTGCTTGGCAACTTTGACGAGGCTGTG
ACGCAAATCTGTATGAGTACGATCCAAACCCACCTCCAGCAGTACAAGGCCGACCCGGCTCGGAATTGGGCGATGAAAGACGTGTCGATCAACCTGGTGA
TTGCTATTTCCGCGATGAAGCAGTCGCGCCTGCGTGGTGTATCTGAGGTGAACAGCCGGGTGCCGCTGATGGACTTTTTCATGGCGGAGGTGCTTCCAGA
ACTGTCGACTCCCAATCAGGCATCGCTCATCTTGAAGGCCGATGCCATCAAGTTTGTCTCGACATTCCGTAGTCAGATGCCGGTGGAAGTCATGGACCAG
CTCTTCCCTCTGTTGATGAACTGCATGGACCCGTCGCAGTTTGTGGTGCACACCTACGCTGCTGCTTGCCTCGAGCGCCTTCTTACCGTGAAGGACCCGT
CCGGCTCGCTGAGATTCTCGAAGGAGCGTCTTGCCCCGTACCTAGGCAAGCTGCTGGAGCACGTATTTAACATCCTTGAGCAGCCCAACTACCCGGAAAA
CGACTACCTCATGAAGGTGATTATGCGGGTGATGAACGTGGCCAAGGAGGACATTTTGCCGCTTACAGATATGGCTGTGAACAAGCTCACCAGTATCCTG
AACCGTATCTGCGCCAACCCCAGCAACCCGTCGTTCAGCCACTACCTTTTCGAGTCGCTGTCCGTCATGATCCTGAACGTCTGCAAAACCAACCCAGCCG
CGACGGAGCGTTTCGAGGAACTGCTCTTCCCGCCGTTCCAGAAGGTGCTGACAAACGACGTCGATGCACTGTCGCCTTACGTGTATCAGGTGCTGGCACA
GATGCTCGAACTCCGACCGAGCGGCGTCTCCGATGCGTACAAGAGTATGTTCCCGGTGCTACTGAACCCTACGCTGTGGGAGCGTGTAAGCAACGTTCCG
GCTATTGTGAAGCTCATTGAGGCGTACATGCGCAAGGCCCCGAATGATGTTGCTCAGTCGGTGCAGGGAATTCTTGGTGTTTTCCAGAAGCTCATTTCGT
CCAGGTCTACTGAAGCGAACGCTTTTTCGTTGCTCCGCGGTCTTTTCGCGTTCATGGCCCGTGAAGCGTACGCGAACTTCCTGAACGAAATCGTCAAAAT
CCTCATGATTCGGTTGCAGACTCGTATGGCTGGCCGCAACTCTGTGGGATACACGAAGGAACTGATCTACACGGTCTCTGTGCTGATCGGAAAGCTGGGC
CCAGACACATTTTTGGCATCTCTGGAAGCTCTTCAGAAGGGAATGTCGACCATGTTTATCAAGTCTGTCTGGCTGACGTGCAACGCTCGCGGTCGTACCC
CTGCTGAGCGAAAGGCCTGTGTTATTGGCCTGACGCGCTTGATGTGTGAAACGGAGCTTTGTGTGGCGGACCTGGATCTGTGGACAGAAATGTTGGCCGC
AGTGGTAAAGGTTCTCGAGGAAGCTGGAGAAAGCGGTGCTGCAGTCAAGGACGAGGATGAAGCGCTGCTGGAACTGGAACAGACGGGATACGAAGCTGGT
TACGCAAAGCTTTTCTTCGCGTCTGTGGTGCCGCTTGACCACCTACAGGAGTACCCGGTGCCAACGCGCTACCTTGCCGAGTCAATTGCGAAGTTGTCGG
CCTCTAAGCCTGGCGTGGTAAGTTGTTTTTTTGCTCATTCAATGCGCTGGGGTGGGGATGTATCATCTCTGACGATTATTTTGTTGTGTTTTCAGCATTT
GGCGTATGCTCAGACAAAACTGCCGACACCTGCGACGCTGACGGCACTGCAGTCATATTTCGCGCAGAACAGCGTGCCATTCCAGTAGATGAAGTAGCAT
GGATCATGGGCAGCATTTCCTGCCCAACATACAATTAGCAAATTTCAGAGTGTGGGGGATGCTGAGCAGCATGCGGCAGCATTTCATCACGAAAGTTCT