Transcript Name :
Physo_134105
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ankyrin repeat5.6PR01415
Ankyrin repeat5.6PR01415
Profile scan predictionP-Valprediction_id
BTB/POZ-like12.267PS50097
Ankyrin repeat12.636PS50088
Ankyrin repeat-containing domain54.832PS50297
Ankyrin repeat14.88PS50088
Ankyrin repeat12.182PS50088
Ankyrin repeat11.514PS50088
Zinc finger, FYVE-related13.324PS50178
PDZ domain8.989PS50106
HmmSmart predictionP-Valprediction_id
BTB/POZ-like2.6SM00225
Ankyrin repeat2.7SM00248
Ankyrin repeat5.8SM00248
Ankyrin repeat2.1SM00248
Ankyrin repeat6.4SM00248
Ankyrin repeat6.3SM00248
Ankyrin repeat0.02SM00248
Ankyrin repeat0.0027SM00248
FYVE zinc finger1.4SM00064
PDZ domain0.0065SM00228
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, FYVE-relatedIPR017455
Ankyrin repeat-containing domainIPR020683
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        4478 bases(100 bases per row)
ATGGGGGCGGAGGACGACGCGCTGGCGGCGGACCTGCTGCAGGTCAAGAAGCTGTTCGCCAACAACCACCTGAGCGACGTGCTGTTCATCTTCTCGTCGG
ACTCTGGGGAGACCGGTGGCGCTAGTGGCGGCGGCAGCGCTGCTGCGACAGCTGACGACGAGTACAAGAGCTCGACGGGGGGCCATCTCATCCCTGCGCA
CCGCCTCGTGCTGTCGCTGCGCAGTGGTGCGTTCCAGGCGGCTCTATTGCGCGCCAAGAGCAGCCAGGTGCCGGGCCAGGTGCGCTTCCCGCTCAAGATC
CACGTGCAGGACACGCCCTACCGCGTGTTCCACTCGATGCTGCGGTTCCTGTACACAAACGAGCTGGGCACAGAGGCGGAGGAAGGCGGGGGCGGTTTTG
GCAGGAGACAGAGAGATAGAGAACAGTTCTGGCAGCAGCTGCTGAGAGCGGCGTTCGTGTACTTGGTGCCGTCGTTGGTGGACATTTGCGTGAAGAGGAT
CGTGGAATTTTTGGTCTTAGAGGAAGAGGGTGAGGAGGACGCTGACAGTGAAACGGCGAAGGTGAAGGCCGAGGACCGGAAGCTGCGGCTCCAGAAGAAG
ACGCTGGATGTGCTGGTGTTTATGGATACGGTGCTGGCGACAAACCCTCTGACTGCTCGAAGAAGAGAAGCGTCGGATTCAACTCCGCCGTCGACGCAAA
ATGGACGGCGATCTTCCAGTGAGCCAGGGGAGGCAGGTGGCTCCGTGTTGTCACGATGCACTGAGGCGGTACATGAACTGCAGAACATGTGCCTGAAACA
GCTTCGGCATATGGATGAAGCAGCGTTTGAGGAGCTCTTACAGAGCGACACAGGGAGGCAGTGTTCGACGGAGAGGCTGTGTGAGGTATTGCGAATGCGA
TCGGATACGCCGTTGGTTGTGGCGATTCGATATCAACTCGGCCGTGTGGTGAACGAGTTGCTGAGACTTGGAGAACCGCTGGAGCATGTTGGAAAAGACG
AATCGGATTTACCATTGGTTGCTGCGCTGAAGACGGGGAACAATGCAATCATTCGTCGCCTGCTAGTTGACGAAAGTGCGCCATTCTTCCTGTTGACTGA
TAAGGTTCCGTTGATATTCTTAGCGAGTGCAAGTGGGAACGTACAGCACTGTGAGATCCTTATCGTGCAGAATGCAGCCGATGTTAACCTTATATCCCAG
CTGAAGGACGGAGACAAAGAGATTACAGCGGAGTTTGGGCATCAGCAGACACCCTTGCACATCGCTAGTCGAAAGGGTCACAATGCTGTTGTCGAACTGC
TGCTCCAGCATAACGCGGCATCCAATCTGCCCGATGAGGAAGGCAACACGGCACTGCACCACGCAGCAAACATCGAAACAGTTGAAGTGCTCCTGAACAG
TGCTTTCAGGACGAACGCCAACATCCCGAACAGACGAGGGCGAACACCACTGCACATTGCTGCCGCGCGTGGAGACGTAGCTGTGGTGGCTTATCTGATT
CGTCATGGTGCCGAACAAGATATTGTGGATGACCAAGGTCAGAGTGCATTCCACCATGCTGCAGCCAACGGCCATACTGCGGTCACTCTGGTTCTGCTTC
ACGAAAACGACGCTACCAAGACTAAAAGCTTAGCTACGCCTGCTGATCGGAGCAGTGAGAACAACGGGGCGGCTGGAGATACTTTGGCGAATGGATCTCA
AACGCAAACAAACAACACTGGCGAAGACAGTGGAGAAGAGAACGCAGAGGAGCAGGAAGAGGCAAGTGGATTCGACATCAACCAAGAAGACTTGAAGGGT
AACACGGCACTTCATCTTGCGGCCATGTCGCCGTCCGAGCGGTGCCAGAAGATGCTCCAGCTACTGCTGGAAAATGGAGCAGATCCAAATCGGGCAAACT
GGTTCGGATACACTCCGCTGCATCTCTTCTGTTCTCACCAGAGCGGCCCAGCATCTCTTATCAGCGCATTTGTAAGTTTCGTATCTGCTTGGTCCATGTG
AACCGTGAATTTACTTTTACTGTCGAATTCGTTGTGCTGCGTGCAGATCGAGCATGGCGTGAATATCCATGCACAGAGTCTAGACGGTAGTACAGCGCTG
CATCTGGCTGTTGGTCGAGGAAGCGAGGACGTAGCTGTCGCGCTGGTAAGTGCCGGCGCTTTCGTGCACCTGCTGGATGCAGCCGGTCGCAGCGTGGTGG
ACCTCGTCGAGAGCACGAACCAGGGTTCAATGCTGGTCCCAGTCCTGCGCAACCTGTCGCATCCGCCTGAATGGATCGGCGATGAGCAGACCACGGAGTG
TTCTTCGTGTCATACGACGTTCCGACTGGCCATGCGCAAGCACCATTGTCGTCATTGCGGCCGCACCGTGTGCTACAACTGTAGTAGCAACAAGATCGCC
ATCCCCAAGTTCCAGGTGCTCAAGCCAGATCGCGTGTGCGACACGTGTTTCGACGTATTATCCTTCCGCAAGTTACTATAAGCACGAAGTTGCCATCAAA
ATGCAAGCACACAACGACAGCAAGCCCTGCCGTCAACCCTCGTCGTGACCAGATGGCTACACTATGCTCTGATTGGTCAATACTCCAGCATCGGTTCAAT
CCCATGTGGGTGGACATTCAAGAACAAGAATAGCTCCTCAAGACCGTCGCCGCCAGCTCCGCCCGCCGCCCCCATTGTCGCCTAGAGCTTGCATCGTCCC
CTCCTCGTGTCATGGCAACTCGTGCTGAGGTGCCGCCGCCTGCACCCGCGTCGCTCGCGCCCGAAACGACGCCACAGGAGCCGCAAAGTGGGGACAAGGA
GTTCTTCGTGCTGAGCAACCTCGTTGGCGTCGAGCTGCGCTGCGTTGTGAACCCCAAATGGCCGTGCGAGGCGCTGCTCGGTGCGGCTGCAGAGGCCTAC
CAGGTCGCCTTCCCGAACAGCGAAGTGCCCGAGTGCAACGTGGTCTTCCACCGCAAGAAGCAGGAGTTCCTGGTGGCCGGCACGCCAATCATTGAATGCT
GCGCCAATCGCGACGAGCTGGAGCTGGGCGTCACACTACCTGCGCGCGCTAGTGCAAACGTTGATGATGCAGCATCCGTTGCCCCGAGCAGCGTCAGCGG
AGTCGACAGCGACGGTGAGACGAGTGAGTTCTGTGTGCTCTTTCATAAACTGCCGCTGGGCTTTACCATGAAGCGCGGACATGACGGAAACACGGAGGTG
GGCACCATTTACCCGAAGAGTGCGGCGACACACTTTCCTCGCTTGACACCGGGCGTGACTATCGTCAGCATCGCTGGTACACCGCTCAAGGATATGGGCC
TTCGACAGGTACATGACCTGATCAAGAACGCGGAACTGCCTCTGGAGATTCATTTCCGAGGACCCGAGCTGGCGCCGTCACTCACGCCAGGGCAGCAGGA
AGCATCGCTTTCAAGACTGTCGGGGTCGGCGGGACCGCCGCCAACTCATCCTCAGCAGGGAGGGCGTCGTAGAGGGTCGTTTGACCGACGCAGTGTGCGG
AGCAGCGGTAGCAACGGTAGTGGCCGCAGTCGCAACAGTCGTAGCAGCGGACGGGGCAGGAAGAAAAGTGGTGAGGTCATTCTTCAGCAAGGTGGTGACA
ATCAGCAGAAGGGCGAAGGCGGCAAAATGCGGGTCCAAGCAGGAGCTCATACCGATGCCAGTGACTCGAATCAGCGAGGCGGGCCTGAGGAGCATGAGGC
TGATAAGTCGGCTGAGGCTGAGCTAGTGGAACAGATCGAGCAACTCAAGGTGGCACTGCTGCGCAAACACGAAGAAGCGAAGCAGATTGCGCGTCAGCTA
GAGATGTGCTCCGAAAAGCTTCTTGCATTGCGCGGTGAATCTGCTGGTGCGGTGCCTCGTGGCCAGCAACAGCAGCAAAAACAGCAATCCAAGCAAAATG
GCACCCCACGTTTGCGTCGTTCAGCCACGTCTTCATCGAGCAATGGCGGATCCAAGGTTCGCCTGACTCCTGAAGTCTTGGAGGCCATGGACCAAAAGGC
GGGGCTCCCTCGGCGTGGCACTGGTGCATACACTTCGTCGAACGTGTCTTCCATCTCGGGGTATTCTGCGCAGTCCATGCCTGCAGCTCGCTCTGCGAGC
ATGCGTGCCCGAAGTGCTCGCGCGGCTGCTCTTGCCAATGCTGACAACGTGTCGGTATCGTCGTACACATCGAACTCATCGAATACGTCTGCACGTCGCG
GTGGCAGTCGCTCGCCTCGGGGCACGGCGCTACGGAACCTCAACAAGCGGTACAACTACATGCCGCAAAAGTATGCAGCGAACACAACGGGTGCTTCGGA
AGGAGGGTCCACGTCATTGTCTTCGCGCGGTGCCGTGATGTCTCGTGCGCGCATCTCGCGCGACTCGTTCATTACCAAGAGCGAGAGTCCTGGTGTTGGG
TACTACGACGTGCAAGTCAAGGATCGCGTCAAAGGGGGTGAAATTGGCGACTCGGACCGCTCCCTGCCGTGGTCTTGA