Transcript Name :
Phymu_g900
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA helicase, DEAD-box type, Q motif6.811PS51195
Helicase, superfamily 1/2, ATP-binding domain28.68PS51192
Helicase, C-terminal10.026PS51194
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain1.1SM00487
Helicase, C-terminal4.3SM00490
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Helicase, superfamily 1/2, ATP-binding domainIPR014001
RNA helicase, DEAD-box type, Q motifIPR014014
*** None ***
InsideOutsideTMhelix
1-681
NN-scoreoddsWeighted Score
0.6270.8520.002
*** None ***
TypeScore
cytoplasmic522
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
*** None ***
*** None ***
Sequence
        2046 bases(100 bases per row)
ATGGCGCAGCCCAAGGTGAACGAGACGCTACTGGACGGACAGAAGCCCTTTACTGAGTGCGAGTTTGGTCTGGACCGCCGTCTCTCCAAGGCAGTGGCCA
AGATGCGCTTCGTGCACGCTACGCTGGTGCAGGTGCATTGCATTCCTTTGGCTATGCAGGGAAAAGACTTGCTGGTGCGTGCTCGTACTGGATCTGGCAA
GACTGCGGCCTTTGCGCTGCCTCTGTTGCACAAGATTCTGCAGCATAAGCAAGATGCTCCTGCTAGCGAGCCCGCCGTGCGtgcgttggtgctggtgccC
ACTaaagagctggtggagcagacGCGTCGCCACATGATGGATCTCATGTACTACTGCCAGGATTCAGTGAGTCTATTGGCTCTGGGAGGACAGAGCATGA
ACGCTCAGCAGGCTTTGCTTCGAGACGCACCGGACGTGCTGGTATCCACGCCTGGTCGTCTTGTGGCACaccttggagctggaaatCTTTCACTCAAGGA
CTCGGTGCAGACTGTCGTCATTGATGAGGCTGACCTAGTGCTGTCTTTCGGATACGGTGAGGATATCCGTACTATTTTCAATGCGTTGCCCAAGGCATGC
CAAACGTTCTGCATGTCGGCCACGCTCAGTCCTGAATTGGAAAAGCTCAAGCGCTCTGTCCTACACAACCCCGCAGTCGTGAAGCTTGAGGAGGGAGCGA
CCGACGGAAAACTACAGCAGTTTTACCTTCCGGTGAAGCCTGCGGACAAGGACCTGCTGCTctacgcgctgctgcgtcttggcgtcgtgAGCGGAAAggt
gatcttcttcgtcaactcGACGGATGCTGCTTACAGACTCAAGCTTTTCTTCGAGCAATTCGTGATCAAGAGCGCGGTTCTGAATGCCAAACTGCCGCAC
AACTCGCGTCAGCATATTATCGAGGAGTTTAACCGCGGTCTTTTCGACTATCTTATCGCAACGGACGATAGCATCGATCGCGATGAAGTTGGagacgagg
atgaagacgatgaggaagacgatgaggaagaggaggaaggtGACGACGAGAAATCCGACGCCGACGCTGAATCTGATGTTGAGAGTGATGATGAGAAGAA
CGATGAAGTAGACAGTGAAAAAGAAGAGAGTGACagcgagaaggacgaggaggaggctaCGGACAGTGGCAATGAGGCTTCCGAAAATGAAGAGggtgat
gaagagcagcaggaaaaGAAGACGGTTGGCGCTAagcgtggacgagctgctgatGAAAGCTACGGTGTGTCTCGTGGTGTTGATTTCCGCGGCGTTCAGT
TTGTTATTAACGTGGACTTTCCGAAAAGCGTACGTGCGTACACTCATCGTATCGGACGTACTGCGCGTGGTGGAGCATCTGGAACGGCTCTGTCGCTTGT
GTCCAAGGAagacgccaaggaggagcgtGCGCTGAAGCGTGTGCAGGCGAAACAGCAAGCCATCCGTTCCGAAACGAAAGACATCATCGCTCAGCCTGCG
GAGTTAGCCTTCGATCTTAAGGAAATCGACTGTTTCCGCTACCGTGTGGAGGATGTTCGTCGTGCTGTCACGCGTGTGGCCGTCCGCGAGGCGCAACTGG
CTGATGTAAAGAAGGAGATGCTCAACTCGGAGCGTCTTGAGGCTCACTTCCAAGCGAACCCGCGTGATCTAAACATCCTTGAGCACGACAAGGTTGTGGG
GTCTGCACCAGTGCAGGCTCATTTGGCTACTATCCCGGACTACCTCGTGCCtattgagctgcagccaccagcaccagcacgcaccaagaagaaacacaaC
AAGCGGCAGCGAATTGCTGATGGCAAGCGTCGTACGGATAACGACCCGTTGCACACATTTGTGGCTCCTGACGCCGACGATGACAAGAAACAAACTGTGG
AGGACCGTATTAGCTACGGTAACAGTGGCGTGGGAAAGAGTACTGCTGGTCGTCAGAAAtggaagaagcagcatcgCAAGGGCCACTTCAACCCCAAGAC
TattgccaagaagaagttcaggATGAGCAAGGGCGCCACTCATTAA