Transcript Name :
Physo_130883
Orientation:
(+)
Number of Exons:
5
Description :
reverse transcriptase
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Reverse transcriptase9.593PS50878
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
RNA bindingGO:0003723IEA
RNA-dependent DNA replicationGO:0006278IEA
*** None ***
*** None ***
Sequence
        3578 bases(100 bases per row)
ATGACCAAGTCTCGACGATACGACGCGCTTCGTTGCCGCGTGGCAGCATCGGCCCCATTCTCGCCGCTCGTCGGGCCAATCAAGTGTGTGTGTGTGTGTG
TGTATGTGCCCCGGTTTCCCGCTTAGATACGGCCCTGCAGAATGGAGTGTCCGGCTGGGCGGGTTTTCCCAGCGCTAGGTAGGATTAGATTGTTGGCAAT
CCTCTCATTTGTGGTCTTACCTCGCCTCGGACAAGCAGCGCCCAAGACCAACACCGAGCGCGGCCCAGCATGAGTCGCTGCCACTGCGCGCTCGCAAAAC
CCACCACACGCTGCCTCAGCTCAGCTCTCCCGAGCCTTCTCTAATAATGAACGGATTGTGTATCTGATTGGTAGAAAGGTAATAAGCCAATAGGAGGTCA
GTGTAGGTACGACTCACCGTAGGTATAGTGAAACCAAGTTAAAATAGATATGCAGATGTAGGGCGGCTGTGGAGGCTTCGCGAAGCTTCCATCCGCCTGA
ACTGCGGGGGCGGCACTCTTAGGTCCGCACGCCCTCCCCCAAGACAGCACTTCTTCCTGTTAAACTGGTAGCACTTGTTGGTCCCAGCAACCTGACTACA
AGAAGCCCATGCCGACGAACGCCCAGCTACGAGCCGAGATCGACCGGCTGAATCAAGCGATGGCAGAGCGCACGCGAGTGCCCACCAATCTGCCCAAGTT
CACCGGCAAGCGGGGGGAAGACGTTCGCGAAGGGCTGTTCCGGATCGAGAAGGCCTGTCGCATCAACGGAATCCAAATCGAAGACGCGAGCGCGCGTCTG
CCGGGTATCGCCGGGTCGGCGATGGAAAAGCCGGCCTCAGGATGGTTCCTGCACTGGTCATCGACGACGAGAAGTAAGGAGCACACGTGGGGGATTTTCC
GTGAGCATGTGCTCCAACACTTCGAAGCTTCGAACTACCAGGCCGTCTTGCGAGAAAAGCAGCAGCGACTCAAGCAAACGGCGGACATCGAGACCTCCAA
CGGCGAGTACTCTGCTCTTATCTCCCGAGTTGAGGGCATGAGTGTACTTGACCAGGTACTAAGCTACGCAAACGGTCTCAAGCCTCGTACCCGTAGCTAC
GTCAAGCTCGAGAACCCAGAGACGCTGAGCGCGGCTATGGATCTGGCGATCAAGTACGAAGTTACGCACTTTGTGGACGACGTGCGCGACCGCCAGTCCC
GCCAAGACAAGACGAAGATCTTCGCTGATCAAGCTCCCAAGCAAGACAAGCCATTCAAAGGGAAACCTTTCCGCGGCAAGGGACGGTTCAAGCCGAGGTC
TGACTCCAAGCGTACTGAAGGCCGCACCTGCTATCACTGCAAGAAGCCTGACCACATCAAGGCCAACTGCTTCCTCTGGAAGAAGGAGCAAGAGAAGCAG
GGAAACGAGCAACCACGTCGGTGAATGAGGGTTCTGGCGTGGGCGAGAGCGTAACCGGGACACCAAAGATTGAGAATATCAGCTTGAACGTTCTGTGCGA
AAACCCTCTGGTCTACAAGTCACGTCCACTGTTCTCCGTAACAGGTGAAATCAGTGTTGGTGACAAGTGTCTCGCGACACGAAGCATGTTGTTGGACTGT
GGAGCTACCACGATCTACGTATCCGAGCGTTGGGTCGAGGAGCACCAGCTTCAGACAACCAAGTTCAGCGACAAGAACATTCGTGTCAAGCTGGGAGACA
ACCAAATTGTCGAGGCGGAGCTTGAAGTTCTGCTGATAGAGATTCTGGTCTCGAGGCTGGACGACGCCTACAAGTGTGTGGCAGTCGTCTACCCGATTCC
AGGCGAATTCGATTGCATTCTTGGAATACCATTCTTCGAAGACGTGCAACCACATATTGACTACGAATCGAAGGAACGAGAACGAGGACTCTGCACTGGA
AGCGAACAGGGAAGACCTGTGAGCCGATCGAGGAAGGCGGACCGGTGATTACCTCCGGGCTTCGGAGATCTGTCGAGGCGAAAGGCCTGTCGGCGAAAAG
ACCCGATTCCTGTCGAGGTGCCGCGCTGGAAACGGATGTGAAGCTCACGGTTGAAGCTGTTGGTGACGCAGTACAGAAGAAATCCCCAAGTGTTGTCCGC
GGACGACATGATAACGCGCAAGCTGGCAAGAGTTCAGCTGGAGACGACGACGTTGCGACGTCTGAGCGCGAGAGTACTGTAGTCGAGGCTGATGGAAGCA
GCAGTACCAGGGGTGGAGACAACGCCGTGGAGAAGATGTTCACGATGGGAGTTGTCGACGAGAGTGGTATACAGACCAAATACATCACGCGCAAGAAGTT
GCGGAAGTTCCTGAGAATCAAGACCAAGACGAGCGACGAGCCTGACTTCATGTTGGTGCTATCGAACGAGACGATCAAGCAAGTTGCACGTTCACTGCAA
CGCCGAGATCAGCCCGACAACGTTGGGAGAGCGAAAGCACAACGCTATCTGGAGACAGACTGGGACACCTTCCGAGAGAATCCAGCTTTCAATCTTCTCA
TGGAGTATAAGGACAACGTGTTTCGTCCAGAACTACCCGAAGGTTTACCAGAGAAGCGTGACATTGAACACCGGATCGATGTGAAGGATCCAAATATGGC
GATGTACAGGCAGCAGTGGCGACAGTCGCCGGAGCAGCAGCGTGAAATCGTGCGCTGGGTCGAAGACATGGTGAAGAAGAAGCTCATTCGACCAAGCATC
AGTCCCCACGCAGCCCCAACATTCTGTGTCCGGAAACCAGTTGGCTGGAGAATTGTTCACGACTACCGGTACTTGAATTCGAACACCGTGCGTCAAAGTA
TCCCGATGACGAGGAAGGAAGACATCCTTGACACCATGTCCGGTGCGTACTGGTTCTCCACGATGGACCTGATGTCCGCGTACTACCAAGTGCGCATGCG
GGAAGAAGACATCAAGTTTACCGCATTCCAAGCGCCGAACGGTCTCTGGGAGTATCTCGTTCTTCCAATGGGAGTTTGCAACGCGCCAGCAACGATGCAC
AGATTGACATCGAAGCTCTTTCGAGACTTGAAGAACACGAAGTCGTTCTACGATGACATCTATGTTTTCACCAAGTCACCGAAGATTGAGGACCATCTGG
ACGCACTGCGGAAAACACTTGACATCTTGCGTGATAACAAGTTGTACGTCAAGCTGTCCAAGTGTGTCTTCTGCTCCGACGAGATGCCGTGTCTCGGAGA
TTTCGTTGGGCGAAATGGAGTTCGGATGGATCCAGACAAGGTGCAGACCATCGAGGACTGGCCTGTACCACGGACGCAAGAAGAGCTTCACAGCTTCCTT
GGCTTGACAGGTTACGTCCAGCGATTCTGTCCAGAGTACGCATCTCTGACAGCCTCCATGTTTGCGCTCTTGAAGAAGAAGAACAAGCGGAACGCCAAGA
TTCATCTCAGCGACGAGCAGCTGAAGAACTTCATGGAGTTCAAGCGGCGACTGTGCAACCCGCCAGTATTGCACTTGCCGGATTTCAGCAGCCCCATGCA
TCTGCGTACCGACGCAAGCAAGTTTGCTGTCGGTGGAGTCCTTTTTCAAGTGGTGGACGGAGTTGAGCGCCCGATAGC