Transcript Name :
Physo_127428
Orientation:
(-)
Number of Exons:
3
Description :
reverse transcriptase
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
TypeScore
nuclear870
GO
*** None ***
*** None ***
*** None ***
Sequence
        2441 bases(100 bases per row)
ATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGCTGAACGTCTTGACGCGTACCTGTGCCGGGTTCCGGTATAGGGAGATGACTCTCG
CTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGGCTTGCACGATGGACGCATCGAGCAAATATG
CATTCTCTCGGACGCCGAGAAAACGAAGAGCGAGAGTGACGAACTGAGGCAGTTCTTCATGGAGAGCACCACTGAAAGCGAGGACACTCTCAGTGCGAAG
ACTAAGAAGGAGCGCTTTGAGGAGCAGAGCGGGGACTCGCTGAAGACGAGTCCCTTCTACGAGATTCTACGGGAGCACGCTGACGTGCTTCCGGAAGAGA
TCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACAAAGTACTGTGTCACGCGGCAGTGGTCACTGCCGCGAGA
GCAGGTCAAGGCGATCGACGGCTTTATTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAG
AAGCCACAGGGCGGTTGGCGCATCGTTCATGCATACAACAAGCTGAACGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGTCATCATCG
ATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCGCGGCTGTGAG
CACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTAAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCACTCG
GTGCGCAACTTCGCACCGACATACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGA
AGCTGCTTGCGCACATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTCGGGAA
GAACGGTGTGCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACG
TACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGC
AGGCCTTCGATGCAGTCAAGCGGGACTTGACTGAGGCGCCGATCTTGGCGGTGGTCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTT
CGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTATCCG
GTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCAT
CGTTGCGAACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGG
AAGACTCAATGTGGTGGCTGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGTCATTGACGCCATGCGATCGAGCACCCCG
ACATCGTCACTGCTGGACGACGTGAAGGTCGCGTGCACGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGTCTCAGCGCCTTCTGACCAAGCTTGTC
AGAAGCTGCCGAAGCATCTTCGTGCTCGTGTACACCGTTATCGGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGTCCGCGTTGT
CGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGACATGAGGCACCCACGCCTCCCGAGTCTACTCGG
GATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTCCGACTGCACCGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCGACTACGCGC
AAAAAGAAGAAACACGCGTCTGTGCAGGACACAGACGCCGACAAGAGCAAGAAGAAGAAGAAGAAGAACGGGTCTGTGCAGCCCACAGACACCGCGAAGA
CGAAAGTAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCCTACAGCGCAGACAAGCCGTCATTCGGTTTGT
CCAAGACACTATTGCAGCTTCTGTCGACCGACAGAAGCTGA