Transcript Name :
Physo_127050
Orientation:
(-)
Number of Exons:
1
Description :
similar to Dictyostelium discoideum (Slime mold). Developmental protein DG1037 (Fragment)
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1779 bases(100 bases per row)
ATGGTCTCGACCCGGACGCCACTATTGCTCACGAGCGTGGATGTGGTGTGGCGCAAGCAGCAGCAGGCGTTGGGCCACCTCCCGCACGTGGCAGCGCTGA
TCTCTGCGTTCCTGGACAGCTCCGAGCTCTGGAACGTCCCGCAGGCGCTGGACTACGGCTACCTGCACCTGCTGCAGCGTCTCGGCGCCACCTCTCGGCG
TCTGCGGCCGCTCTCCAACCGCAGCTGCTTCCTGTCGGCAGCGCAGCGTGGGGACATCGCGATGCTGCAGTGGTTGGCTGCCTACGACCCGGAGTTCGAC
GTCTACGGGGCAGTTCTGGACCACGCGGCGGAGCACGGCCAGCTCCACGTTGTCCAGTGGCTGGACCAAACCTTCCCGGACCTGCAGGCCAGCACCAAGG
CCATGGACTTGGCAGCGGCACGAGGCCACCTAAACGTCGTCCAATGGCTGCATACCCACCGATCGGAAGGCTGCACGCATCACGCTATGGACGAAGCGGG
GGCGCGAGGACACGTCGACGTGGTGCAGTGGCTGGACGCTCACCGCCACGAAGGGTGCACCAAGTACGCCATGAACTTCGCCGTGTGGTACGGCCACACT
TCAATGGTGCATTGGCTGCGCAAGAATCGGAGCGAGGGCTGTAGTGTTCACGCGATGGTGTTTGCAGCCAAGCGGGGGGATCTCGCCTTGTTGCAGTGGC
TGCATGAACACAGAGAGGAGCTGCTGGCTCCCGGTTCGGACGAAAACTCGCCGTTGATCATGGACCACGCGGCGGAACACGGCCATCTAGAGGTGGTCAA
GTGGCTACACGCGAACACGGACGGAGGCTGCACGACGGACGCCATGAACGGCGCAGCGCGTGGTGGGTACATTGACATCGTCGAGTTCCTGCATGAGAAC
CGTCACGAGGGATGCACGAGCAACGCGATGGACGGAGCTGCACGCGGTGGTCATCTGGACGTTGTAAAGTTCCTACACGAGCGACGCCGCGAAGGTTGTT
CGTACCTCGCGATGGACTACGCGGCTGCCGAGGGTCACCTTGATGTCGTACAGTTCCTGCATACTCGTCGCAGTGAAGGCTGCAGTCCGTGGGCCATGAA
CTCTGCTGCGGGGGGAGGACATTTGAGCATCGTCAAGTTCTTGCACGAAAACCGCAGTGAGGGCTGCACCGAGCGGGCTATCGACCGTGCAGCAGCCGGA
GGATTCCTCTCAGTTGTGCAGTTTCTTCACGAGAACCGGTCGGAGGGCTGCACGACGGAGGCTATGGACGCCGCTGCGTGTTTTGGGCACTTGAATGTGG
TGCAGTTTCTTCACTCGAATCGCAGTGAGGGTTGCACGAAGAATGCGATGGATGCTGCTGCGCGATGTGGCCATCTAGACGTCGTCAAGTGGCTGCACGA
GCACCGCACTGAGGGCTGCACGACAGAAGCGATGGACGGCACGGCTTGGTTTGGACACCTGGATGTTTTCCGCGTTTTGCATGGACATCGTAGTGAAGGC
TGCACTAGAAGAGCAGTGCGTGACGCTGTGATCGGTGGGCATGTCAAGACAGCTCAGTGGCTGACAGAGATCTGCCCACAATGTCGAGTGAGCAGTGGTG
CGTGTTTTGATGACCAGGGCGATTTCGTGCCTGCTGCCTAAACTCCGCGAGTCTTCGGGTACAGAAGACATCGAAGACGTGGGATTCAACTACGAATCGA
GCGGCTAGCATGAATGCAGGTCAATGGATTCCTAGGAGTTTACAGTGCCGATATGTAGTAAAAGATGTTTTTTTATTCG