Transcript Name :
Physo_159042
Orientation:
(+)
Number of Exons:
1
Description :
PsAvh63
This protein is a Signal Peptide
This protein has transmembrane domain
Reviewed by Brett Tyler
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
GOLD5PS51257
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5080.66126
InsideOutsideTMhelix
1-102
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        309 bases(100 bases per row)
ATGAACCTGCGATCTGCCGCGCTTGTTTCCATCGTGGCTACCCTCTACGCCTGCTGCATCGCTCAATCCTCCGCCACCGCCACGGTGTCTGACCCGGCTA
GTGCGATTCATTCTCCAAATGAGGCCCTCGTGGTGGGCAAGCGATTCCTACGCACGCCCGTAGCAGCGGTCGATAAGGGCAAGAGCGAAGAGAGAGGGCT
GGATTGGTTTACCTCGAGTGCTGCCAAGGCGCTGAAAGCCCAAAAAAGAAAATGGATCAAGAGCGCGGAGATTTACGAGGATCTTGTCATGCACCAGAGG
ACTACGTAA