Transcript Name :
Physo_159167
Orientation:
(-)
Number of Exons:
1
Description :
PsAvh211
This protein is a Signal Peptide
This protein has transmembrane domain
Reviewed by Brett Tyler
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.4640.66218
InsideOutsideTMhelix
1-98
*** None ***
*** None ***
TypeScore
mitochondrial478
GO
*** None ***
*** None ***
*** None ***
Sequence
        297 bases(100 bases per row)
ATGCATCTTCGATCTGCCGCGCTCGGTGCCTTTGTGGCTGCCCTCTACGCAAGCTGCATCATGAGATCTACTGCCACCGCCACGATACCTGAACCGGTGA
CTGCTATTCAATCTCTGAGTGAATCCCAGCCCGCCGACAGACGCTACCTACGCGCACGCACCGCAGTCGACGCTCATGACGGCAAGGAAGAGAGAGGGTG
GTTCACCCCCAAGCTTTCTGCAGGGGCAGAAAAGCTAACCAAAAAGCAGCTGAAGGGCATGGTGGATAAATATGTGAGACCCCGAGTTTTACAATAA