Transcript Name :
Physo_127049
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
TypeScore
nuclear565
GO
*** None ***
KO ID
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
K01539
*** None ***
Sequence
        2002 bases(100 bases per row)
ATGAGCAGCGCCCAGACGTCGTCGAGGCGCTCCAATAGCTCCGACAGTGCGTCCACCGTTGCTGGGCCCGTGAGCGTGGCCGGCACCACCAACGGCAATG
GCTTCCGCAGCGCCGGCGGCGATGCGCTGTCCATCGAGATGCAGTTCTTGAACCCGCGCCGGCGCTTCCCGCTCGCGAACGAGTACTTGCCGGCTGTGCA
CGTGACGGAGGAGCAGGTGGAGGATCTCCGCGAGACGTGCGAGCAGCTCACGGCCGACGCGCTCGAGCTCACGGCCATGTTCGCGTGGGAGGACAGCAAC
AACAACGACCTCGTGGACGAGCACCGCGACCAGTGGAAGGTGCACTACAGGCGCCCGCACGTGAGTGACGCTGTACCGCAAGAAGCGCGGCAAGGACGCG
GCTGCGGACGAGCTCGAGGACTCGACGGATGACAGCAACGGCGGCCTGCGCCACTACGTCGTGAGCGGCCAGATCCACGACATGTCGCTCGAGGACGTCA
AGTACGGACTGCCACGCTGGACGAGCGCGCGGTCATGACGGACTTTTACCGCGAGTTGTTCCTGGACGCGGCGGTGCTGCGGAGCTTCGAGACGCAAACG
CCGGAGGATCCGTTCCACTTCTTCGGCATCAAGTGGCTGGCGCACCTCAGTCCGGCCGACAAGCTCATCTCACCGCGTGACTTCGCGTTCGTCGAGTACT
CCCGCAGAGTGGCGGGTCCGAAAGGTGAGCCGCTGCTCGTGAAGGTCCAGCAGTCGTTAGGTCCCGAACACGTCGACGCCATGAATCGCCGCGAGTTCGA
CTTGGTGCGAGCTCAAATGAGCTGCACAACCGTCTACCGGCACGACAAACGCGCCAACAACGTACAGGTGATCGCACGCGGGTATCTGGACCCGTGTGGA
AGTGCGCCTGCCCTCATGACCCGGTCCTTCCTCACCCGCTTGGCCCCTACACTCGTCGAGGTCGAGCACAGTGCCGACGTCAAGTACATCATGCGCCACG
GGTTGGTTCTTCCCAAGGAGAAGTTCTTCGCTCGTCGTGAAGCGCTTAAGGCCCACGGTCGTCACCTTCTGCAGTGCACGGCTTGTGGCAAGCGCTTCGG
ACGGTTGAAGCGTCATTTGACGCAGTGTCGAGCGTGTGGCGAAGCGGCTTGCGGTCGGTGTCTCATGACGTACACGCTGTGTCTCCCGCACCACGAGCGT
CGCAGTGCTGAGCACCCAAGTGCTGTGATTCAGGAACGCTTCTGCCTGCGTTGCCTGTACTCTGGTCAGCTCGACCGCAAGGGCCAGCGCATGGACGATT
TCTTGACCAGTGGACGTGTTGGGCCTCCAGCTCCGTCAATCACAGCCCCGACGGCCGACGACGATGAAGAAGTAGACGATGACGATGTGTCGGTCGTGGA
ATTCGCCATGCTAGACGATGGTCCGATGCACACCGCCATCTCCGAGGCCCAGCGACTGCAGCGCCTGAAGCAACGTTACCTGGAGAACGAGAAGCGCAAG
TATCTCAGTAGGAACCACGAGCAGACCCCGTGCAGCGGTTGATCATGGAGCAGCAGCACCAGATGCACCACTACGAGCAGGCAACGCGGAGAGCTAAACG
CTCTTCCATCCCCCAACAAGCAGCCAGCCAATGCTGAACGGCTCCGTGGGCTCTTCGTCCATCTCGTCGGCACATAACTCCGTGTCGTCGGCGTATAGTT
CGCTGTCTATGACCAGCTCTACGTATTCGTCCGCGGAGGCTGCGGCAGCGGCCACCGCTGCACTGCAAGCCACCACCGGCTTCCACGAGATGGAGCACTC
CATCGGTGAGCAGGAGGCGTTGCTGCGCTCGCCTCAGAGCGAATACGCCAAGCTGAGCTTGCAACGAACTACGCAGCGTTCGCACTCGAACCCAACTTTC
AACGCGCAGCGGATGCGCGAGAATCGATTGGCCGAGTGGGAGGCCGCCGAGCGCTCGCAAGCCACATCGACGTTCGACAATCAGTATGACATCGACGACT
AA