Transcript Name :
Phymu_g34
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_362533
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-278
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K00915
K00915
*** None ***
Sequence
        1045 bases(100 bases per row)
atggaGGGCTTCACGGAGATGGCACACCAAGTGGGCGGCCATGCCACGAGTACTGACGCGTGCAATAGATAATCTGCTTATCCACATCTAATACGTGCCT
CTTCCACTGCGTTTGACAGGTCTAAAGGCTCATAATGGGTGTATCCTGAAACCTTTCCAGAGTAAACAGCGTGGCCAGCGAGAAGCAGATTTCTACAATC
GCGTTTTCGTGTCGGAGAAAGATTCACCCGAGTTTGTAGAACTGAGGAAGTTTTTGCCGGGTTATCATGGCACAATGGAGGTAGAAGAAGGCAAAGAGAC
TGGAGGCCTGCATTCTGGAAGTATGAACGGTTCCAATGGAGACTATAGAGCTTCTGAGTTTAAAAACTTACGGATCTGTTGCTGAGTGCAGAGTATTTAA
TGCTGGACGACTTGACGTGGGGGAGACAATGGCCTTGCATTATGGACGTGAAAATGGGCGCCAAGTCCTATGAGGACGACGCGACACCAGAGAAGATCGC
GTACGAAAAGTCCAAGTTTCCCTTACAGGAGACGGTGGGATTCCGTATTCAAGGGATTAAGATGTTcgacccgaagaagaaggaatACGTCGAGTTTGAC
AAGCACTTTGGGCGTGGCGTCACATCTGCAAATGAGCTCGTGCCCGCCTTCCGCAAGTATTTCCCACCGGAAGACACGACCAAGACCATCAAGTTGTTGG
AAGCGGTTGAGTTTGCTTTTAAGTGTTTGCTCGGTAAACTGCCAAACCTGACGCTCTTCGTTTTGCATCCAGTTTTTGCAGCGTCTGGATCAGTTGAAGG
CGTGGTTCGACGACCAGCAAAGGACGGAGTTTATCGCCAGCTCGTTCCTGTTTCTATATGACGGCGAGGAGTCggccaaggacgacaaggGCGTGGCAGA
GGCCTACGCAGCCGACATCCGTCTCATCGACTTCGCCCACGTGACGCAGTTTGCATCTCCCAAGCGCGACGAAGGACTGCAGACTGGCATTGCCACTCTG
ATCCAGTGCTTCCAGGCCCTCCTAAAGGAAGTTCAGACCGAGTAA