Transcript Name :
Phymu_g3
Orientation:
(-)
Number of Exons:
4
Description :
arginine biosynthesis bifunctional protein argJ, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-465
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K00620
K00620
K00620
*** None ***
Sequence
        1601 bases(100 bases per row)
ATGACGCTCCTGCGCTTATCGACGCTCACCCGGTCGCGCTCACTGCTGCAATCGCGTTGCCTGTCCACGCACAGCCACCCGTTCGTGTTCGAGTCTCGCC
ATGAGTACATTGACTACCTGCAGGCCCATCAGAGTCGACTGCCCTGGGGCTTCGCAgtggccaccaccaagcTCGACTTCGTGCCGCAGGAAGCCCCCCA
CCTCCCGGCCAAGATGACTATGACTTTGATTAAACCCGTAAAGCCCACGTCGCTTTTCGCTGCCGTTTTCACGCAAAACGCTTTTCCCGGAGCCCCCGTC
CTGGTGGGTCGCAAGCGCCTGAGCGAGCCGAAACTCGGCGCTATCCTCGTTAACAACAAGATATCCAACGTCTGTGCGAGCGGTGGTGGTGTGGCTGATG
CAGAGGAGGTGTGTGAGAACCTGGCTAAGCACCTGAGGCTGGAGGGGGGCACACAAGTGCTGCCCTGCTCCACTGGCGTCATCGGCTGGCGTATCCCTGT
CGACGCTATGGTCGAGAACCTGCCCAAGCTCGTGAACAACTTGCAGTCCGACTCGGTGCTGCCTGCTGCTGAGGGAATTATGACTACTGGTGAGTTATAT
TATTTTTGCCCCGAAAGAAGTATACAAAACCTCACGAATTGTGTTGGCGACAGACTTGTACCCGAAGATCCGCTCCATGGACGTGTGCGGTGGTCGTATC
GTCGGTATTGCCAAGGGTGCGGGTATGATCGAGCCCAACATGGCTACGATGCTGTCTTACATCCTTACGGGTAAGTGCAGACATCTATGAAAAGGTATAG
TTTTAGCGAACTAACTGAAATTCGACTTTTGATGCAGACCTATCGATTCCGCGTGACGTGCTGCGTCAATTGCTGACAGAGGTGGTGGCAGACACGTACA
ACGCGCTCAGTGTGGACACCGACCAGAGCACGTCTGACACGGTGACGCTCGTTTCGTCCGACCAGATCCCGTTCGACctgaagcagctggacgagttcaa
gaaggcgctgcacGAGGTGTGTCTTGGACTGAGCGAGGACATTGTGCGCAACGGTGAAGGTGCACACCACGTCATGCGCGTGCGTGTGAGTGGCGCCGTG
TCCAAGGAGATGGCCAAGGGAGTGGGCAAGTCGGTGGTCAACTCGCCGCTACTCAAGTGCGCTGTGGCGGGCAACGACCCGAACGTGGGCCGTCTGGTCA
TGGCCGTGGGTAAGTACATGGGTCTGCACCACAAGGACGTGAACATCCAGCGTCGCATGAAGATTCGGATGGGTGGCGTTCTCATTTTCGAGAACGGTGA
GATGGTGCTCAACGACGAGATTGAGGCCAAACTCGTGGCGCACATGCGCGACGCAATGCTGATCGAACCCACGCGCGGAGGCCTCGATGCCAGCTCCCAC
AACTACCCACCGCACGGAAAGTTTGTCGAGGTAAGTGTGTTATTTTATCTAACTCGGGTGTATCATTCTAACGTTTGTTCTTTTTTATTCTTCAAATTAC
AGATGGAGATTGACTTGGGTGTCGGATCCGAGGAGACGCAGGTGCTTGGCATCGACCTCACGCACGAGTACGTGGCCATTAATGCCGACTACCGCTCGTA
G