Transcript Name :
Phymu_g39
Orientation:
(+)
Number of Exons:
5
Description :
regulator of chromosome condensation (RCC1)-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Regulator of chromosome condensation, RCC11.2PR00633
Regulator of chromosome condensation, RCC11.2PR00633
Regulator of chromosome condensation, RCC11.2PR00633
Regulator of chromosome condensation, RCC11.2PR00633
Regulator of chromosome condensation, RCC11.2PR00633
Profile scan predictionP-Valprediction_id
Regulator of chromosome condensation, RCC113.74PS50012
Regulator of chromosome condensation, RCC116.594PS50012
Regulator of chromosome condensation, RCC113.539PS50012
Regulator of chromosome condensation, RCC115.911PS50012
Regulator of chromosome condensation, RCC115.228PS50012
Regulator of chromosome condensation, RCC110.785PS50012
Regulator of chromosome condensation, RCC113.981PS50012
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Regulator of chromosome condensation, RCC1IPR000408
*** None ***
InsideOutsideTMhelix
1-424
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1588 bases(100 bases per row)
ATGGTGCAGGTCTTGCTCGGTGCTCTCCGTGCTGCAGGCCGTCGTGCCGCCGTCTCCAGGTTCCTGGCCAGCCGCAGTATGCTCCGAGCTGCCTCCTTCG
CTACTCAGTCCAGTGGTACGTCGACCTAAACTTGTATTTTTATAGTTTTATTCGTTTTAGTCTTCTCTAATTTTAAtccgtttttttttttctgggTAGT
ATACACATGGGGCAATGGTACATTGGGTCAATTGGGCCACGGACCCGTAGTGAAATCAGGCATCCGTAGTGCGTACGAAGAGCTGACGCCTaagctggtg
gaggcctTCGAGGGCAAAGCCATCACCCACGTCGAGTTCGGAGCCAGCCATAGTGCTGCCAGTACGTCACTTGTCAATTATTTTATTATTTTAAAAGCAA
CACTAGAGTGACATGGTGCTCTAATTATTTATTTCAGTCGACGAGGAAGGACGGTTGTACGTATGGGGCAGCAATGAGTACAGCAAGTTGGGCCTCGGAG
AGACCAGcgacatggaggagctcCCGCGTGAAGTGGAAGCGCTCAAAGGCATTAAGATCGTGGATGTTTCCTGTGGTGATTACTTCACTGCGGCCGTGGA
TGAGGACGGCAAAATGTACTCGTGGGGCTGGGGAGGTTCCACCATGaaaggtgctggaggcctTGGCCATGCCGGTGGAAAAGACGAGCCCACTCCTCGA
CTGCTGACCACTTTGGTGGACCAGGGAGTGCCTATTGCCACGGTTGAGTGTGGCGAGTTCCACACGGTGGCGCTCACCAAGGATGGCGAGATCTGGGCCT
GGGGTAATGGCGAGTACGGACGACTGGGAAATGGCGAGTCCGACACGTGCGAGGTGCCTGAGCCCATCGAGTTTTTCTCCAAGGATAACATCGTGTcgat
cgctgctggacgcgacTTCTCCTTTGCTTTGACGGACAATGGAGAGCTCTACAGTTGGGGAGGCAACAGCCGTACGTTGATTTCAGCATTCTTGTCGAAT
TTTGGGGTGATATTGATTTTTTTCTATTGTGATGGATACAGAGAACCAGTTGGGCATTGGTGGTGGCCTAGCCATGGACGTGTACAACATCGAGTCAATT
CCTGTACTAGTGGAGGCTTTCAGCGGTTTATCTGTGAAGCATATTGCGGCTGGATACGACCACGCCGCCGCTGTGACGGAGGACGGACGTCTGTACATGT
GGGGCGCCAAGATCTGGATTGAACCGCGTGAGATGACGGCCGTGAATGAGCACAAGGTGGTGCAAGTGGCTTGCGGACGGCAGTATACGGTGGCCTTGAC
GGATGATGGCAAGGTCTTTACGTTTGGCAAGGGAAGTTCCAACTGTCTGGGCCATGGCGACCGCAAGAACCAGTTGCAGCCTGTTCAGATCGAAGCTCTG
GCCGATGTGAACATCACTTCGTACGTCAATTGGCACTTTGGAACGGTGGGCTGATGATAGAATGGAAAATGCTCACTTGTCGATTGTTTATTGTGTGACG
CAGAGTTTCGTGCGGCGACTACCACATGGGCGCCATCGCGACACCCCACGCCGAGGCCGCAGACAAAGATTTTTCCTTCCGGGAGTAG