Transcript Name :
Phymu_g16
Orientation:
(-)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site7.767PS50096
Ankyrin repeat-containing domain46.554PS50297
Ankyrin repeat10.419PS50088
Ankyrin repeat8.897PS50088
Ankyrin repeat10.766PS50088
Ankyrin repeat11.407PS50088
HmmSmart predictionP-Valprediction_id
Ankyrin repeat2600SM00248
Ankyrin repeat15SM00248
Ankyrin repeat0.018SM00248
Ankyrin repeat350SM00248
Ankyrin repeat700SM00248
Ankyrin repeat0.068SM00248
Ankyrin repeat0.044SM00248
Ankyrin repeat0.046SM00248
Ankyrin repeat11SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-2243
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        9867 bases(100 bases per row)
ATGCGCCGAGCTACGGAGCTCGGAGGACGTCGACACCATGACCAGCAACGTCTTCTagtggaactggagctggacgactcgCTGTATCAACACTCCCAGC
GACTGGGGATGGAGAACAGTGCATTGTACCCAGACGAAAGGAGATCAACCTACGCTGGTGACGCACGTCATAGTCGGCATCGTAGCAATGGACAACATTA
TGCTGCTGAACCAAAGCAGTCATTGCCATCAAGAAATCATCGAGATACAGCGGCCAAGCCACGTACGGAGCGCCAGATGCAGCAACTTCACGCCAGGCGC
CTTTCGAGCCCTtacaagctgaagcaggaagTCTTAGGTACGCGACACGACCCGACATCCCTACGCCATCATCACCACTCCCcgcacagctccagcgcgg
GATCATTGCAGCGGGTGACGCGCTCATCATCGTTGCAGAAGACGCCTGCTGGCCTTGTGATCGAGTCGGTCCAGCAAAATATCCACTTACGGGACCAAGT
GATGGCTCAtgtgcagcaggagctcatgggggtgctgccactgcacCGGGCGTCTCAtgtggagaagaacgtgcCACAACGAGTGGTAAAACTGCTCAAC
AGGATGCGCAGTCTGTCACTCGCAGTGGTGGAAGCTGTAGTGTATCTGAGCAATGAGCTTGGAGCTAACATGACTGGCACGAGTGTCGAGCACGACATTC
TGGAGCGGGATTTTTACGGATACCTACTGCAAATGGCTTCGTCCGATACAGATTTCCTCGCGTGTTCACCACCACTGCAACGATTCTTTGAGGACTTTGA
AGTGAACTTGACCCGTAACCCTTTCGTGGATGGATTATCATTGGACTCGTCGGAGGTTCTGCTGTGTTCGTGCCACCAAAATGCGACGTCCGATGTTTTA
TTTGGttctgcgtcgtcgtcatcgtcttcgcttTTGCGATTGTTGACGCATAAACTGGAGACGTTTTCACTCCAAGCGCAGCGATATCTCCCCGGATGGC
AAATTTTACCGGCAGAACGTGTGGCAGCGGCTTTACTGCATCTCATGGATCTTGAAACTCGTTTCAATGCTGTGCAAATGCTGCCAAGATACCTCCAGTC
GCACAGTGGCAATAGGAGTCGACCGATTCAACAACGCGATGAACTGGAAGGTGGATACGGCACTTTTGGGGGCGAAATTATGCAAAGATTGGATCGCCAG
GACCCGCGATTATCATACTCAGATCATGATCTACTACGAAATGACACCTCTGTGATGCAAGCGTGGGCTGGTTCTCCAACAGCGAGATCCTCAATGGAGG
TGAAGTCACCGTCTTCTAGAGTTTTGGTGGCTACTGCGTCTAGTCAGCCATCGCTAGCTCAAACTTCGGATGACTGCGCTCGAAGGTTATCAAGTGGATT
CAGAGAAGCTAGAGGGTTATCACCACAAGATGAAGCTAGGAAACCATCGTTACCGTCGGTAGCATGGGTACCACCGACAAGCCCAACTGATCTTGCATCT
GTACGAGCGAATACGTCTTTGGAACCATCACCTTCTGGTTCATCCCTACCATCGACTCTAAGAAAAATGCCGGGGGCTGATGTTGGGATTGAAGAACCCA
cgcaactggagctgccagTAGCTATGGGTGACATGTCGGCAGCAACGAAATCATCTAGCAGAAGTGAACGATCTGCATCGGAAAAGAAGAACAGAAGTGC
TAAGGCGGGGCACAACCAGGTGATCGATGTTGGGGTTCAAATGAGCGTACGAAATACTTCAAAAGACGCTGTCGATGTTGGAATCCAAATGACCCAACGA
AATACAGCTACAGCGGGTATAATGCAGACAACGCACAGGTCAATGACAAGCCCTTCAACAGACGAAGGGGTTCAAGTTCGCAACGAGGACTCTAAGGAAG
ATATGCCTTGTGGAATTCACGCAAGCCAGCCGAGtacggcaacaacaactgCTACACAGACAACGCACAGGTCAACGAGAAGTATTTCTGCTCGTTCAAA
GCATGACGAAGGGATCCAAATGCGTGATGATACTGCCAGAAGTCTGTCTGTCTCGTTGTCTGAACTTGAGCTCGATGCTGCGGGTGTTTCTTCAAGATTT
TCAACGTTGGTGCCGGAGATAAACGTCTCCGAACCTCTAGAGCTGGTTGATCATCTGTCATCAATAAGGTctgacgatcttctcgtcgtaAACGGCACAG
AACCAGCTTTTTTCGTGCCATCCATGGTAAAACCGTTGGTTTTGTCTCGTACTGTAATGGAAGGAGAAATTTGCGCTGTGGGTGCTCCAACAACGGCGAA
TCAGGCTATTATCTCTGTAGAAAGCGGTGGGGAGGCCGAACAAGGCAGCGACGATATGTACGAGTGCGACTTTGAGTACTCGTCCAATGAGGCTTTGTCC
AGTATCGCCATGGCCATGCAAATGCTTCCCAATTTTACGCTGTCGACCCCAGAGTCTACTTTACCTGATGAGGTATTGAAGTCAGAGGAAACCACTTCTC
CCATTAAAGCTGCGAGTCTCTTGTCGACCAGGACGCAAGAATTTCTGGTGGATCTTACCAATAATGTTCAAGTATCCACTCCTATGCAAATGCTGTTGGA
GGATGGTGTGTCAATGGAACTCGCTGAGAGCATCGagcaaaaagaagaaacccCTCCGCTGGAAGATGAATTCGCCTACTCCTCGAGTTCAGCTATTTCG
AACATTGCTATGGCTCTGAGTCTGTTGCCTGGTGTGTCGAGAGATGACATTTTCTCTGTTCCTGAAGTGGAAAGTGAACATGAGCTGGAAATTCCTATGG
ATGTGAGTTCTTCTAGAATCAGCACCTACCGATCTATAATCTCTCGACTGGAAGAACCTTTGagcgctgaagctggcgaagtATTCATGGAGGAGGCGTT
AGATTATGGGGCACCAGTGTCATCACGCAGAAGTGTTTCAGTGAATATGACAGACCAGCAGGTATTTCCCGTACTGCCGTCACTTCTTGGCTTTAATTCC
TCTCTGACCAGATTAAGATCGGTGGATTTGTCTCCAGTTTCTGGTGGTAGCAGTGTTTTGGTGGCAAACAGTGATCAAGCGATACTTTGCGAAACCCCAG
TCGTCATTAGCCGAGAAATGGAGCGTTCGGTTCCTGCTTCATCCCGTAGCGCCATCTCAGCAGCTACGAGCTACCAAGGGGACAATGAAAGTGAACAGTC
CGAATTTAACAAAATCTTCGAGCTCTGTCGAGATATTCAAGGGACTGCATTCGGCATGAGCCATTGGGTTTCCCAGAGAGAAGTCGAGGACAAAATTCAG
TCGTTCGCACAGCCGTATTCGTCCCTGATGGGTTACGCTTCCCCAGTGAAGACTAGCCATTCTCCAAAGTATCTGGAGCGCGAGTTGAAGATGTTGCGTC
GGAATTTTGCGTGGTGGAAGGTCTGGGTAGTGGATCATAAACGAGCGAAGGTGGTCGTCCGCAGATTAGTGGCAAGGCGGAAGATTCGACAGTTTGTGAA
TTTTCACCATTGGCGACGCCTGCAAGCCCGGATACGGGAAGAAAATGACCGTCGATTCcgcgcagcgtctcgaatACAACGGAACTGGAGGATTTATCTC
CAGAAAAGAGAAGTTTCCTCACGTAAAGATGCTTTCTGTGTTCTTCACATAGCGTTTTACCGGACAAAGTTTTACATGGGTATTTCGAAacgaagatgtc
gacgtGAATacgcgaaggagaaggttgtgcggtggtggagacagcagcgatcTCGTatcaagaaaaagaagcagcGGCTGAACCAACTTTCACGAGAACG
CGagcgaagagctcgagctcggaGGGAAATTCAAAAATTCCTGAAAGAAATTCTACTTCGACGGAAATtgaaagctgctcaagagatgacgaagaacaTT
TTATTCAaggagcagttgaagtggaccAAGGCCAAGCGAGACGTGGAGAGGAGTATGGAGCTCAATTCAAAGCATAAAAAGGATCTGATTGCCGACATGG
ACATGAGGTTAGCAGATCTCGATAGGAAGTGGAaaactgcagaagacgaacggCTGCGACTGCTATCGCACCATGATCGCGTAgttcaacagcaacagca
ggcAGTGGAGGTACGACGACGTAGATTGGCGGCGCTGAAGCTCCAAATGTTCTTCAGAGTGTGTCGCCTacacaagaagctgcacagaGCTGaagcgcag
aagcagcagtatcAGGTCAGacttcaagaagagctgcttACAAAGCAACAGCGAGATTTTGAGACCCAAAAACGTATGAGCCAATCCCGTACACAGGCGC
GCGTTTTGGAGAGAAAACTTGATCGCCttgcacaagaagctgcgaaaGCTGATACTGCGCACCGTGAAACGGTTCAAACTCATCTAGCAAGAGAAAGAAC
TGATCAAGAACGCTATGCACGACAGAAGATCAAAGCTTTCATCGATGCCAGGACGTTAACTAGAAGAGCAGACACGGAGCGACGACGGTTGGTGTTGGAG
CAAGCGCGTCTGCAAGCGGAAAAGACCGAAATTGAACTCATGTCAAGTGAAGAGCAACGTGAACAACGTCGAGTAGCTTTATCAACTGCTTTGGACCTTC
AGCAACGCCTGTACGATATGGAAACTCGATCTGAAGACTTACGGGCAGCTAAAGATCAATTAGCAGCGGAcaaagaggaggagaggcgacaagcagcaga
ggcTCTGGAGCACAGTCGAGTCGAAGCCAGTATGCACCAGATAGCGTCATGGGTTTCAGGACAAGTGCAGCTTTCAaggctcaagaaggagcaagcTGCT
ATCACTGCATTGGCAGCGCGTGAgttggaggaggaaaagcaGAAGCATCGAAGCGCCAATGAGGCTAAGATACGAGAAATTGCCTCTATCAAGGCCTCGA
ACTTACTCCACCAACGCACTAGTCAACATCGGAaccagaagacggtggaggcAATCCGGAttcaacaccagcagaaaACTGCCCAGGAGAAGACGATTGC
AGCTCGTACTCGAACTCAGTTAGTacagcttgtccttgacgtCAAGCTACTGACCGAGCTCGAGAGTACTAAAGGCATCAGTCAGGGTTTGACAGGTGTG
GCTCAGTTCTACAAAGCTCAGCTGCACCAATTCGCGAGACTGAAGCTCTTGCGGAGGCTAAATTGCGCTCGGAAGATCCAACGAGCTTGGCGTCGATGGA
TTCATAGGAAGAGAGTGGAGAACGCACAGCAACTGGCGCTTGTTAAGCTAGAAGAAAATAAGCAGCGGCAAGCCTCAGCACGAAGAGCGCAAGcgtggtg
gaggaagtggactCAAGAGCAGCGAAGCCGACgggagcagaagcgcatcTTTGACGAGCACGTGGGAGCGATACGACGGAGAGCTAACGCGCGTAAAATT
CAAGGTGTTTGGAGGCGATGGGTGCAGTGTCAGCAAGAGCGTAGACATCAACAACGACTCGCATTCGACAAGCACCTGGACACGATACGAATTCGTGCAA
ATGTGCGAAAAATTCAGGGAAtatggagacgctggaccAAACGTGAGAGCGATCGAAggaggcagcaacagcttgagTTTGAAGCGCAACTtgaacaagt
acgagtccgaGCACATGTACGCAAAATCCAAGGAGCGTGGAGGCGATGGGTCGAAACagagcgagagcgaagaaTCCAACAGCAATTGGTGATTGATACA
CGGCTGAAAGCCATACGCGCTCGAGCGGATGTATGCAGGATTCAAAGGAGTTGGAGACGTTGGAGTTTACGTgaacgagagcgaagaaTTAAGCAGCAAC
TTTCTTTCACGAAGCATCTTGAAGAAATACGTTTGAGGGCCAATGTCCGTAAAATTCAACGTGCGTGGAGACGGTGGACCCAAGGCGAGCGGGTGCGAAG
GCACGTTCAGCGCTTGGCGTTCGATGCGCAGCTAAAGGTTATCCATATGCGAGCTATGGTACGTAAGATTCAGCAGGTGTGGAGACGTTGGATCAAGGCC
GAGCGTGAACGAAGGCACCAGCAACAGGTTGCGTTTAACCAGCAGATTCAATTGATTCGAGACCAAGCTAATGTGCGTAAGATTCAAGGAGCTTGGAGGC
GGCGTACCAAACGAATTCAAGATCGACGGCGTGTTCATCGCTTAGTTTTCTCCCACACTCTTCGCATTCAGAGatggtggaggaagtggcggatgaagca
gcgagtGAAGAATACACGGAACCGGATCATGCAGAATGCTTGTGCTCAAGTGATTcagaggaagtggagaagctggcatCGATGGCAACGAGCCAAGCGA
GAAAGGCGACGTCTTCGATTTCAACGAGATGGTTGTGCTAGGAGACTACAGAAGAATTGGCGGCAGTGGCGAAACTGGAAACGTAGGCGAAATGCAAGTG
CCGTTCGAATACAACGACGCTGGGCGaagttgcagaagaagaagtcgcgaGAGATTCGTGCTGTTGAGCAGATTCAAAGACtgtggagacgatggcacAG
GAAATCCCTCGAGAGAATtgaacgtgaacgtgaaGAGGAGCGCCAAGTTGCGCTGAAAATCCAGCAGAATTGGACTGGGAAGCTGTTTAGACGAAGCAAG
GAGCAAGCTGAACGCAAACAAGCTCTGGACGAGCAACGAAGTACGCAACTTGAGAATGAGAGGCAGCGCCTGTTAAAACAGGAACACGAGCGTAGGAATA
AAGCTGCGTTGGTAATTCAGAAACAGTGGCGAAAgatggagcagttcgaggcTGAGGAGCATTTGCTACAACAACATGCGTGTGCGTCGAAGATTCAAGA
GCTATGGCTAACGCGTCCTGCTGCAATTCGAAGACTGGGAAATGAGGAGAATCTACAAGAAAACACAGGGGATGATtttcaacgagaagaaaaacgaTCA
AACCAAGAGGAACGTGAAGAACAGCAAGCGAGGGAAACTCAAAACACGAGCTCTTTGAAGATCCAGCGGAATTGGGGGATTCGGCAGCACCGACGTAAAA
TGGAGCGGCAGCGTGTTCAACATGAACAACACATGGCTGCGTTAAAGATCCAGGCATTGTGGCTTAAGTGGCATCAcgaacaacaagaagaactcgaacg
TGAGCGCATTCGACAGGAGCAGGACGAAAGTTCTTTCAAGATTGAACGGAACTGGGGGGTGTCTCAacaacgaagaagagtttCGCAGGAGCGTTTGCGT
CACAAACAAAACATCAGCGCTCTCAAAATACAAAAACACTGGAAGAGGTGGCGGAATCTCCGTCTTGAACAGCGAACAGATAGCAAAATTGCCAGCCCCA
TCACTACAGATGCAGAACAACTTGAGCGCGCTAAAAAACTGGAGGTTATCACACGTCGTTCCTATGGTCGATGCGTCACACGTACAGTAAAGAGATACCA
TCAAAACCAGCGGGAGCAGAGTGCAGCTACGAAGATTGAAGCTATTTGGAAGGGAAAACTGTACCGAATGCAGTatcttgaagcgctggagatgaaacac
gacgaggaagctcgACAATATCGCGTGTTGATATCGGTACTCGCAACGAAAGTGCAGATTTGCTGGCGTCAATGGCAAGTGGGTATTCGGCAAGCTAAAC
GAGCAATCGTGAAAAGTGAAGAGTTGCGTTTGATCCAAGAGGCCAGAGCGCTTGAAAAGAAGCTACTTGCCGCCAAGCGTACGTTGGCAGCAAAGCGAAT
TCAACGGGCTTTGGCGTCTCGGAGGAGTCTGATTGCTACAAAAGGTGTTTCCCACAGGGAAGTTGTTCCGACTGCATCAGTGGCTAGCATTAAGTCTATT
GgtgaagtggatgaagaagagcacgtTGAACAACCTCAGATTGAAGAATCTGAACGAAACATCCAAGAACTGAAGCCAGAGGAAGTGTTGATGCGAGCGA
CAGTGGAGATGACCGTGGAAGATTGGGGACATCGACAGCTGCCGCATATTCTGTCGCGTAGTGTGAACCAGATCCTGTTCTGCcatgaagcagcaagtgc
gaTTCAAAAGTGCATTCGGAGTTATCTAAGACGTCGGCGGATGAATTTCTGCTTCCAACGTTCGTTCAGCACCTCAGAAAGTGAAAATGTTGGTACTGAG
CACTTCAATTTCTACTTCAAAAGAGCTCGTGCCTGGCTGGATTGGGAGTCCACGTCGGCCCCCACAACCCGCTTGCTCCGGCTTCGTTTGGACTCGCAAG
TGACCCGCAAGCTACTGCAAGTGTTCGGACCAAGTGAAGAGTACACGGAGTCGGAGAGTCGTCAAGTTCTACAAGAGATTGCGGCTGATGTGTTCCCAAT
ATTACACTCTCCAGCTTGCGTGGAAGATAATGAGAACCCGATGCCTGAACTCTGCTATCACGATTTGGAGGAAATGGAGCTACCTCGATCTGTCAAGCTA
CTGCGTCAAATGGAAAAGCATCGCGCTTATCTTAACCGCCAGGTGCTTCTAGAGGTCGATATAGGTGCCGAAAAGCCTACTGCAGCGTTGTCCGTGCCAT
TACCGTCATCTCCAATTGGAAAGTCTGCAccgtcatctccatcacaTCGAGTGAAGAAGGAAATGACGATATTCACGGCAGTAGAAACAGCATCAGTTGA
AGACGCTACTTTCCTTCAGCAACGAGGGTTTGATCTGGGAGCTCTCGAGGCAAAGACTCAGCGGAATGCGCTACACATGTTGTCGTTTTCCAAAGAAAAT
TACAGATCTCGCGCTGAAATGCTGGAGTTTTTGCTGAGTTGCGGGGCCAACTTGAACGTGAATGCCGTCGACTGCCATGGCGATACACCATCGATGCTAT
ATGCGTCACTTGGTCACCTTGAATTCAtaaagaagctgctgcaacatGGAGCTGATCTCCTATTGACCAACAGCAGAGGCCAGAACGTGCTGCATCGAGC
TTGCGAGGCAGACCAAGTGGAGATATGCGGCTTcttgcagcagttgatgaTGAAAGATTCCATCGCAGAGATCATTATTCCAGTTGAAACTATCGCGTCC
CTTGTACCAGCGTCACTTTCACTCCACACACCAGACAGAGGAGGCCGATTTCCGCTGCATTATCTTGCTGACAAGGGGTTTATCGAGTGTGCCAAGCAAC
TGGTGGTCTCGATCGAGTCTAATTTTGAGTGGAATCGTAGTCTCCAAGCACAAGGAGATGCCGAAGGTCGAacagcgctgcatcttgcTGTTCTTTCGCA
TGACGTAGCCATGACAGCTTACCTTTTGACCCCAGGAGGAGGCTCCGACGTCAATGCCTTCGACGATCTGCACAGGTCTCCACTGCATTACGCGGTGGAA
TCTCCTGCTGCGCTCCCGATCATTTCTCGGCTGGTTCAACATGGAGCAAACTTGAATGTAGCAGACGAACGAGGTGACACTCCGTTGCATTGGACAGCGT
TCTCTGGTCGCGCAGCCGTCATGCAGAGCATCTTGGCGCTTGGAGCAGACCCAACACTACGCAACAGCGACTGGGAGAACCCAGCACAGATCGCTGCGGC
GTACGGTCAACTGGACTGCATGCGGCTTCTCCTGCAAGCTCAACGGCGTTTTGGAGCGTCACAAACTGAACCAAGAGagcaacaaccagcactAAACCGT
CCAGCTAGCGAGACGACGGTTCTGCAAAGACTGGCGGAAGCAGTGGACCATCTTCACCAGAAACAAGCTTCAGCCCACTCAATGCGTGGCGATGAGGACG
CCGATCTCAACCTCATGGAGCACGaaacagctgcagctgagcaAGCACACGGAGGCTACTGGGAGGAACTGCACCAAgacgtgcagctcgtggaagagAG
CGGACAGTTCTCGtctgaagacgaggaagatctGCTCTTTGGCACTGATGATGATCCAAGCTTCTAA