Transcript Name :
Phymu_g41
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_532690
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Src homology-3 domain10.6PS50002
HmmSmart predictionP-Valprediction_id
Src homology-3 domain1.2SM00326
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-588
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1886 bases(100 bases per row)
ATGCAGCCGACAGGACGTGGAGTTATTTTCGACGGGGTCGTCTGACGATAACAGCCGGCCATCTACTGTATAGCAGCGCTACAGGAGGCTCAAAGCGCCA
AAGAGTTCACCTCTCACGACCAACGAGTACGCGGCGGTCGAGGCATGTTGCCGGCGCTTACCACCAAGCCGAAGCAGGCGGTGCGCCAGGTTAAAGGCTT
GACGAATGACTCGATCGATTCATACTCGAACACGCCACTGGGCGGCAGTTCTGGTGGGATGGCAGCAACGTACGTGGATAATACCGAGTCGGGCAACGGT
ACACCACGGTcgccgccagcttcgagcagAGCGATAATTAACACTGGACGTGTGAAGTCTGCGACTGAGGAAGGCTTGGTGATGGCTCGTGTAGTGAGGG
ATCGGAAGGCATCGGGTGAGGAGGAATTGTCACTACGTACGGGTGACATCGTGAAAGTTCTGTCCTCCAAGCGCACCGGATACCTGAAAtgtgaagctgg
agacgaagtgGGCTACGTACCATCGTCCTACTTGGAATTCCTAGACAGCAACGTTGAAGAGAATGGCAATAGTAACGCTGTTGGTGATGAAAGTCAGCGA
GCAGGTGAGAaacagcgcaagaagaaaaaggagaagcggaagaaggagaaacgGGAGGTTAATGACACTAGTGAGACCGAGGAAGCGGCTCCACCGACCG
CCCGCTCACCTCGTAAAGAAGTCGCGAACACTGAAGAGGACGGCAACGAGTCACCTCgcaagcggaagaagaaagaccGGAAACATCGCGACGCAGGTGA
AGACACAGCAAGAGGGGCAGTAGTGGAGGGATCGCCCAGTGCCAgatctcgagcgacatcTGAAGACACGGAACGAACTCGTAGTAAAAGCAAAcactcc
aagaagaagcgccaccgTGATGTAGATAGCAGTGCTTCGAGTGAGAGTGATGCAGGGAAGCGTAGTGCTCGCCATAGCCGCcgtcgccatcatcggcGCG
GATCAAGCGCGAGTGACTCCAATTCAACGTCTTCGGACGATTCAGACGGGAGCTAcagacggagacgacgtcgtcgacgtcaccGACATcgtcgcagctc
cagtgaggacgaagatgaagacgataGCGACTACAAACGCCGCTCTCGACGTAGTAGAAAGCGTCGTGATAGAGCTAACGGAGATTCGGAACCTGACGAA
AGCTCTCGgaaggccgagaagaagatgtcgGCAACCGTGCAAGAAGTTGAGAAAGGAGTGAGCAAGCTGGATGTCAAGGCCGAAGAAAAGGCGGAAGCAA
AGCCTACCGCTCCGTCAAGTAGGAAGGAGGAGCCGAGTCGAGACAGAGGCAAGAAGGAAGAGACGGAACGCAGTGAAGGTTCTTCGGAAGGACGCGCAAC
GAACGTATCATCAAGTCGGAAGGATGACGAAGGACGGACGAGTACCAGTACTTCGTCCTCCAACAAGCAAAACAGTAGCAAGTCTGGTCTTGGCAGGCAA
ATCGGTGAAAAAATGCGGTCATTTTTGGCCGgtggcagcaagaagcagcacagtAGCAAGGGTTCAAGTGGAATTCTGAACGCGTGTTCGGGTACTGTGC
AGGGTGAAGAAGGATGGTACGAACATGGCGAGAATGAACGCTACTACTTCGTCCTTGTGGACGGGAAGTGGAGTCTTCTGTACGGACCCATGACTGAGGA
CGACTTCGAAGTATATTCTAACCGGGTACGTGGCTTGTTTGGAACTGACTGTCTTGATAATATCCATGTGCTAACTTTTGCTGGCAGGTGTTGGAGCAAA
ATCGCACTATTGAGCTGCCACCGACGTATCTGCACAAGACTGGATACTATCTCAACCGCGAACTGCGtgtgcagaaggagcagtaA