Transcript Name :
Phymu_g22
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, BED-type predicted9.855PS50808
HmmSmart predictionP-Valprediction_id
Zinc finger, BED-type predicted0.0074SM00614
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-812
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
DNA bindingGO:0003677IEA
*** None ***
*** None ***
Sequence
        2439 bases(100 bases per row)
ATGGTGAAGCGCGTTGCTGCCAGTGCGGAATTCCTACCTGCATCGTCCGCCGCGTCGTCGGCGCCGTCCACACCTGCAGGCCAAGCGACTCCGCTCGCGA
ACGGACCGGCCAGCGTCTCGGCTGTGTGGTcgtacttcgagaaggacaaCGCGGGCAACTCCGTCTGCAAGTTCTGCGAGCGCGTGATCAAGGGCCACCA
CTCGTCCAACCTGCTCTCGCATCTACGCACGGCTGGACGCACAGACCCGACGCACCAGCAGGCCAACAATGTGTGCGAGGAGCACAGAGAGACCAAGCGC
CATTTgaagcgccagaagctcgGCTTACAGGCCGTTGCGGCTGGTCAAGCGGGAgagctcgtggctgcagccaTGTACCCGCCTCCTGGGGCTTCTCAAG
CGCTGGCGGCAGCTGTGGCCGCGGCTGGAGGCTCTCCAGGAGTATTCACAGCTGCACTTAAGAGGGATCCAACGGCTGCCTACTACGCGTTCCCGTCCTC
GGCTCTGGCTATGACCAAGGAGCAGAAAGAAACTCTCGGCTCTCCTTATGGCCTGCAGCCCGTGCAGGTTAATGCAGACCAATTCACCCAGGACCTGGCT
CTGATGGCGCTGATGGATAATTTACCGCTGAACTTTGCTTCCAAGCCGGGGATAAATTACGTCATGAACCAGCTATTCggagacaagaagctgccacTGC
CCAGTGAAGATATCATCGGGAAAAGTATCCTCTTGCTGCAGGAGAGTGTGTTCCTGACCACGAAGATGGTTCTAGCTAGAGCCAAGAGTGTGGCcgtgtc
gctggagctgtggcaaCATCCAAGTCCGATGGAACTCAAACCGACCTACCTGGCTGTGAAGATCCACTTTAGTGTAAACTTCAGACTCTTCGATATTGCA
GTGGGCGCCGCTCCGCTCGAGGAAACTGCTGGAGTGGAGACGGTCAAGTCTATCCTTGACTCGTACCTAGAACGGCTGGGcatcaaggacaaggtgaTTG
CTTGCATTAAGGATGAACTCCCTGCGAAGAGTGACTTGACGGCTTCCGATGTCCCGTCACTTTTCGTCCCTGTAAATTTCGATGGGCGGGTTGCCTCGCC
CGACGCGGCGCAGAGTACGTTTCTACTGACGTCAGCGGTGCAGCACCTGCGTGTCTGCTTGACGCGAGATGTTTTTGAGAAGGCATTCCCGGAAATGATC
AGCCAGATCGAGGACTTTGTGGCTCGACTGAAAAATAACGACAGCGCAACGCTTTCCATTTGCCGCAAGTGCCCGCTCTTCGATATTGAGTTTTCTCCGG
AAAATCGCGAGACAACGTCATACTTTGAGTTCCTTCGTGACTTTCAGGATCACTTGCCTACACTGAATCAGATCGCAGTCGCAAATGTCGTGGCTTATCT
GCCTGCGTCGGCGGTTGAGTCGATTAGCCTGCTAGTGAAGAAGTTGCGCGCATTTGCTCGGTATTCCGAGGCGCTCCAGGGTGAAAAGAACAAGAAAACA
GGCAGCGACAAGGAGGTGTACAAGAATGGCATTTCGAGTATCTCAACCATCGCTGCGGCTTTGGTCACGTACGCGGAGAAGCAAGCGCAATCAGCAGTTG
AGGGTATTCCGGCCCATTTGGATCCCACCGCGTGGAAACGTTTCTTCGAGATGTTAGCACGCAAACTGCGTGGTCAGTTTGCAACGTTGCCGCCGGTTTG
TTACGCTGCGACGCTGTTTGACCCGCGCTACAAGAACCGAGAATACTGTTATTTGGCCCCCAAGATCGATTGCGACGTCGGCCAAGATTTTCTCCGTCGT
ATGTTTACTGACGGAGATTCGATGCAAACATCGAATGCCTCCAATTCCGCGGGGCTCTCGGAATCTGGTGCGGACTCTGTCGCTAGAATGGCAGCATCCG
CTTATGCTGAGCTGGATAAAGACTCTACAAGCCCGACGGCCAATGATGCTAGTCTtgctgacgatgaggatgacgATCTGCTTTCGCACCTTCCGTCAGA
ATCATCCAAGTCGTCACTTCAAGGTTCGAGCGAGATGGTGGCCACTTgggagaaggagctgagcgCTTTTCTAAGCCTTCCTGTATCGGAACGCAACGTC
GATCCACTCACCTGGTGGAAAACAAACCAGCTTCGCTTCCCGCTGATCGCACCGTATGCGGAGATGATTTTGTCGATTCCGGCGGCTTCGTCAAGCGGCG
AAACTGTCCGAAACAACGTGCATAGTGTACTTCTGCGCACTGAAGGCATTGGTCGCGAGACTGCGCTGGCCGAACACCCGGCTATGATAGAGGCGTTGTT
GTgcttccagaagaacaaAGAGTACGCGCTTGAGTGGTTTCGATCGGGACCCACCGCCACTGGCATGGCGGAGGCTGCAGGACTGAGCGCTGATCTGGAA
AGCAGCGCCGGGGGCTTCAAGCACATCGAAAACGTGTAA