Transcript Name :
Phymu_g47
Orientation:
(-)
Number of Exons:
1
Description :
folate-Biopterin Transporter (FBT) family
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5090.71925
InsideOutsideTMhelix
1-11
67-78
128-308
374-384
445-490
35-43
102-104
332-350
408-421
12-34
44-66
79-101
105-127
309-331
351-373
385-407
422-444
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1473 bases(100 bases per row)
ATGGCGATGGCTTCAGCTCCGATGccactggcgctgctggcgctgtactTCCTCCACGCCTTCTGCATGACGTTCCCAACGACGGCGTACGGTACGTGGC
TTTTTGACGTCATTCACATGCCACCAGCCACGACGACGCTGTATTATTCGGTCACTTTCTTCCCCTGGAACCTCAAGCCTCTCTACGGCCTTCTGTCCGA
CAGCTTCCCGCTCTTCGGATACCGCCGCAAGTCGTACATTATCATCTGCGAAGTATGTGCAGCTACGTCTCTGGTTCTTACAGCCACGTACGTGCACTCT
ATCGCTGGAGCTTTCatcgtgaagctcgtggacgctgtggctgAAGCTTTCGCGCAGATGATGCTCGGCATCTTTCTAGTGAATCTAACGACGGGGGATG
ctacaagcagaagcagcgctcGCGTGCAGTCATTTGCTAATGGAACGAAGAACGCGGCTTCTATTATGGCCTTAGTGCTGGGCATCCCAGTGTACCTGGA
CAAGAGCATCACACCCCAGGAAGTCATtggctggagcagcttcttcccaCTCACAGCAGCGGGCGTATGCCTCTTTGGactgaaggagacgccggTATTT
GAATTTACAGGCAGTGAAACCGAACGCTCCGGTGAGATTGGAGACGTGGTTGCAGCGGCCTCGTGGAGAAATACGGTATTGTCGTGGTGGCTGCCGTTCA
AGCGAGACCTGCAACACAAAatggagctcatcaagcCCGTCCTCCCGCccatggccttcttcttcctgtgcAATGCACTGCCCAACGATGGAACAGTCTG
GTACCAGTACACGTACTCGCTCCTCAATGACGAGCACGAGTGcttgcagtacatgtacctggcAGGCATGATCGGGCGCTTCCTCTCGTGTCTGTCGTAC
GCCAAGTGGTGCGCTAACAAGAGCGTCCGAAGCGTCTTCCTGCTGTCGACAGTGTCttccgttgctgctgggctgCCTCGACTGTTATTGGCTCCTCCTG
TCGTTGATCTCCCGGTCTCCGTCTGCACGTTCGGCACGGCGGAATCGTTCATCACATCCTTCACCTCGGagttcgcgctgctgcagttgctggtcGTGGC
CACTTACTATTGTCCAGCCAATCCGGAAGTGCAAGGACTCACGTACGCGTTGTATCTCTCGTTCATGGACTTCGGGGGCGTCGTGTCTGGAGTGCTCATG
TCCTTTGTGGTGTCGATACTTGGCATTGTACCCGACCCAACCACGAAGGTTGTGGATTGGGACAATCTCTGGCTGGTCGTAGTGATCGCTTCGGTTGGCC
AGTTGCTCGTGTTGGTCTTCCTGTACGTACTGCCGGAGAAGGTTGACACATCCGAAAACACAACAGTTGGAGGAGGTCGGGTGAAACTCAAGTCGATTTC
AATGACTCCAGACGAACCGGAGAAGCAGCCATTGCTGTCAGAGCCTGAAGCATATGCAGACGTGCGAGTGTGA