Transcript Name :
Phymu_g9
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_289190
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-203
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        612 bases(100 bases per row)
ATGGACTCAAGGTGCAACAAGTTCTGGGAAGATGGTcaggcgctggtggccgCTATCTCCCGACCGGACAGCGCTGCAAGGATGGAAACGACACGGGCCA
AGATTTTCAAGGAACTGCGCACAATGAGTCGTTTCCTGCAGCGCAACCAGAGCCAGCGATTCAGTGACGCGGCACAACAGAAACTCGTGGATTGTGTGGG
GCACTACGTGGGACTGGGGAAGCAAGGAGGAGCGATGCTGCCAATAGCTGAAGCTACCTTTCAAACGGTGAAAGACGGGCTTGCTATGCCTTTCAATGTG
GTCggcaccaagcagaagaagcggttgcTCAAGTGGTACAATGAGCTTATTGCAATTGTCGGTGGAGATTCCGACGCGTCGattgctggagaagttgtCG
CTGAACCGAGTATTGAGTGGAGCGTCATGGACATCGACGAGGACGGCTTCCTGTCGCTTATGCAGGTGGAAACCGGTGAGACTAACGAGAGTTTTcaggt
caagaagaagaccgcaGAGTACAAACGCATCAAGAAAGCACTCGAGGACAGCGAGGTTACTGTAGTTACCAGTGGGGATGATATTCAGGAGATCCGAGTC
GACAATGAGTAG