Transcript Name :
Phymu_g40
Orientation:
(-)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-622
NN-scoreoddsWeighted Score
0.6041.4860.003
*** None ***
TypeScore
cytoplasmic435
GO
*** None ***
*** None ***
*** None ***
Sequence
        1869 bases(100 bases per row)
ATGGCGGACATCTCGCACTATGGacctgcagctggagacgcggCGTCTTCACCGCTGTTCCGTGCATTAAGCGTGCGTTCAGGCAATGTGGTTGTGCTGG
GGATGCAGCGCTTTGCTTCGGTCAATTGCGCAGGTATGGCGCTCTTCCGGGTCTTCCAGGGGAACGTAGAGGTATTGGGATTCCGACCTCCTCTAGGCGT
GTATTTCTCCTTGCATTCGCCCAAATGGAGCAGTTTGGTGGTAATTGAAGGCCGATCAGGGAACGAAGACACCCAGTCGCCTTTCGGACCTACGAACGCC
AGTCTGTTGCAAGCTATGGAGCCGAATTTACCAGCGGAAGCCGtgaatgaggacgaggagatcgctGCCGACAAACTGGCCATGCAACTCGTGGGCAATT
TCCCCATTGTATTGGTGCTACGTGCCATCCCTGTGACGTACGGGAACATTATGAGTTTCTATGAAAATACACGACCAGAGAAGCTGTCGGCCGTTCTTCC
AGGTTTCAAGATGATCATCTCAAAGCACAACCAGAGCGTTTTGAGTGCGCTTACAGCTGGCTTCGACTGCACAAGTGCCGCTCCGTTAGATACAGATCCA
TCCCATCATGACTGGAAGACTCCGGAACGAGTTCTCGCTGAGCTAGTGGTCGTGGATTCCTTCAAGACGTTGAGTTTTACTGAGCATTGGCAAGCGACAG
CCGACAGACTGCAGTTGAGTCTACTGGAGAACGCGACGCCGCAGAAGATCGTCGTGTGCGGAGGCAAAGGCGTGGGCAAGTCGACGTTCTGCAGGTTTCT
AGTGAATCGGTTGCTGGCCAAGTTCGGCACTGTGGCTTTCCTGGATACAGATTTAGGGCAGAGTGAGCTCACGCCGTCCGGACTGGTGGCGCTCCATGCG
TTGACGACGCCGCTGCTCGGTCCGGGTTTCTCACACATGAAGAACCCGATCCGGTCGTTCTTCTGCGGCAACGCAAACCCTGGCAACGACCCGCTGTACT
ACATGAAGGCAGTCAAGAGTCTGCTTCGCCTGTACCAAGTCAAATGGGGGACTCAAGACTCGAACGTACCGCTGGTGATCAACACCGACGGGTGGATCAA
GAGCATGGGCCACGACCTGCTGTGCAACGTCATACAGGAAACGAACCCCGAtcacgtcgtgcagctggtGGCCGCCACCAAGAACAAACAGTTCGACGTC
CCCACGGAAGGCAAATGGCGTCTCCACGCCGTGCCGCCTTGGGATCCCGTGGGCGTGACGCAGCCTCCTCGAAGCTCCAAGGAGCTGCGGACCTACCGCT
TCCACTCGTACTTCCTGTCTCGCTCTCGTTGCGTTCTCCCGCGGGCCCAGCTCCAGAATCTCCAAGTCCTGTCGGAAAAGAACCGTCTGGACGGCGATAT
CTACCGCGCGTACGCCCAACTCACTCCTTTCGCCGTGTCCTTCGACCACGTGGACGTTGCGTTCGCCGGTGCGTCCGTGGCTCCCAGTCAGCTCCTCTTC
TCTCTCAACGCCTGCGTCGTGGGTCTCTGTATCAACCCCCAGTACAAATCGAggagtgacgacgaagctgaaggaccGCCACGGATCGTTCTGCAGCCTA
TACACGCGCCGTGTCTGGGTGTGGGAATCGTTCGAGCTGTGGACGCTGAGAGACGTCAGCTGTTCCTGTTAAGTCCGCTGCCCCTCTCAGTCTTGAAACG
AGTGAACGTACTGGTACGCAGCAGTATGCCGCTCGATAGCATTCTTTTATCTGCGCAGGAGCCTGCTCAAGCTCCGTACGTGGTCACAGACGTTGTCGCA
TCGGACGGCACGGGCTCCGCTGTCATGCAGAGTCGCAACAACCTCAAACGCAAGCGCGACGGCAAGTAA