Transcript Name :
Phymu_g46
Orientation:
(+)
Number of Exons:
2
Description :
60S ribosomal protein L13, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-206
NN-scoreoddsWeighted Score
0.6612.2530.005
*** None ***
TypeScore
nuclear783
GO
*** None ***
KO ID
K02873
*** None ***
Sequence
        845 bases(100 bases per row)
ATGGTGAAGCACAACAACGTCATCCCCAATGGCCACTTCCACAAGTACTGGGAGTCCCGAATCAAGACTTGGTTCGACCAGGTACGATCCAATACAGCAA
TTCAGCTAGACAGCCAGCCACACAGGATTGCGTTCGGTCTCTCCATTGGAGGCGTAACAGGTCAACCAAAACGAGGGAACAGACAGTGAATTCATCAGGT
TGTCGGGAATGGAGAGACCGACAAGACCATTTGGCTGGCTGGGTGATTGCAGCGACAATTAAAAGAGTAGGGCGCTGATGTGCATTGTTGTGCTAATCAC
TACAGGCttccaagaagaagacccgCCGTCTGAGACGTAAGGCTAAGGCCGCTGCCATCGCCCCGCGTCCGGCCGCTGGTCTGCTGCGCCCCGCTGTGCA
CTGCCCCACGATCAAGTACGGCTCCAAGGTCCGTGCTGGCAAGGGCTTcacgctggaggagctgaaggaggctGGCATTAACCGCAAGCAGGCCATCAGC
ATTGGCATTGCCGTTGACTTCCGCCGCACCAACAAGTCGGTCGAGTCGCTCCAGGCTAACGTGCACCGCCTCAAGGCCTACAAGGCCAAGCTCGTGGTGT
TCCCGcgcaagagcaacaagacTAAGAACGGCGACGCCGCCGCTGAGGACGTGAAGAACGCTGTGCAGCACACCGGCGAGATCCTCCCGATCACCCGCTC
GAGCATCAAGTCGACCACGGCCGTCATCACGCccgagatgaaggagaagagcgtgtTCACGCAGCTGCGTGTGGCTCGCGCCGACAAGCGCATCTTCGGC
AAGCAGGCCAAGCGTCTGGCTGACGctaagaaggagaagaagtaa