Transcript Name :
Phymu_g42
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pleckstrin homology domain15.935PS50003
C2 domain13.712PS50004
C2 domain15.074PS50004
C2 domain11.951PS50004
C2 domain8.976PS50004
HmmSmart predictionP-Valprediction_id
Pleckstrin homology domain1.6SM00233
C2 domain1.7SM00239
C2 domain2.1SM00239
C2 domain1.6SM00239
C2 domain30SM00239
C2 domain0.24SM00239
C2 domain18SM00239
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pleckstrin homology domainIPR001849
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
KO ID
K15290
*** None ***
Sequence
        17574 bases(100 bases per row)
ATGGAAGACGTGCAAGGTGACGCGCATTTGGTGTCAGTGGCGTCctgcgacttcgacgacAGCATCGGAGATTCTCCAACGCCGCTCTGTACGTCTCTGC
TGTTCTCGCTTCAATTTTACATCGACCATGTCGCGTTAGAAGCCCCTgtggcgtctccagcagcttcgaactCGCTTCTCCTTGCTTTCCAGCTGTTAGA
GTATGAGATTGTCGTGTTTGACGCCGCATTGGCCTGTCCTGCAGCCTGTACACCTTCTTCTGAAGCTGTAGTGACGAGGTTTCGCCATGGCAAGTCCTGT
CTTTTCGAAGCAGATCCGGCCGAGTTGGCACACGAATTGCAGAGGGACGTGGAGCTCCCATTAACTCTGCTTTTGCTCGCTAAGGAGCATGGTAGAGCGC
GACTTCGAGGCTTTTCTTCTGTGGCTTTGTCTCTTAATGTTGGGCTACTGGACGAAGACCTGCTGAATGGCAGTACGTTGCTTCGTATTTGTGAGTGGGC
AGGTCAGAACGGCTCGTGGGAGCTGCGGGACCACCACAATGCAATCATTGGGAGAGTCACGGGAGCTGTGACGCTATCGTGTCTAGGCAAGACGCTAGCG
CCGCATTTGAAACATGCGTTGGGGGTGCAAGTGAACAAGTCACAACCGTCAAGTCCACGTGGGGAAGCTGTTGTTGAGAAGGAGGCAATCGTGCAGCCTG
CGACTGCTGTTGATATAGGTGCTGTCGCTTTGCTGGAGCAACACACAACAAAAATGGATGCACGCGAAGAAATCACGCTGGAGGAAAAAAcaaagaagct
ggagaaggtaGACTCGGGTGTTCAATGTGATGAAGACCAGCTCATTGAGGATACGGCCGAGTTGGAGCCGTCACTGCGAGCAAGTTACAGAAACAATAAT
GGAACTTCAGCAGAGCAGTCGAGCGAGACAATACCCAGGCACTTCAATATGGAAGGTCCTGTGCTCTACCATAAGCGCAACACCGCGCAAAACGGCACAT
CAAGTCCGCGGCGCATTTTTTCAAGGCGCATCTCTCAAAAATTAAAGGTGCCGGTCGCTGCCATCAAGGGAGATCTGCTCTTACCGCGAGAATTACCACC
ACCGCTGTTCTTCCAGAAAGGACTCCGCAGAGTAGATTCGTAGAATCGGCAGACTAATTGCGCTTTGCAATTTTGCCAAAACGTTGAGCGAACTGAATGG
CTTTGATCACCGCCAACATGGTCTCAGAATCTCGTAACCGCCCAACGCAGCACTGGCAACGCACAAGGCCCAGGGGGACGCGACGACGCTTCAAGGCGAT
CACAATCTTTTCATCAGACACTtcagaagagaagaagcgagcTTCAGCGAACAAGACAAAGAAGtgaaagaaggagaacagAATTGAATTGGACTGGAGA
GGTAAAGGAGACGCTCGCGTTAAGACATCTCCCTGCGATGAGTGAAGAACGCTACATCAAGGAGGGATGGCTCATGAAACGCAGCCGACCAGGCAAACTC
ATGGCCAACTGGCGCAGAAGGTACTTCCGCTTGAATCGCACCGAGCTTGTGTATTTCAAGACGCCACAAGACACAGCACCACGCCGCCGCTATAAGCTGA
CTCTGGACTCAAGTGTACTCCGGACCAATGACCACGGATATTCCCTGTGCATCACGTTCCAGCCTGCTGCAGGGAAACCATGTTTCTTCATGCAGGCGGA
gaacgaagtggagaaggaagagtGGATTGCCGCCATTTCCAATGCTTATCGCCGAACCCCGGATGTAGCACAGCAGACATCCGTCCCCAAGAAGCCGGTG
GCTCAGCCGCCCCCTCaacctgctcctccttcccGTATTCTGCTGAAACTGGTTGTAGAGGAAGCTCGCAACCTTAAAGCTGCCGATATGAACGGAAAAA
GTGACCCATACTGTGTTGTGAAGCTCGTTGGCAAGGATGGAAAGATCATCGATATCGAGGAGAAACGGACAGACGTGATTCcggcgacgctggagcctGC
ATGGCATGCGTCGTTCGAAATCGGTCGAGTAGTAGACATGAACACGGTGAAGGCGGTTCGGTTCGACTTGTGGGATCATGACGCTTTCACGCGGCATGAC
AGCTTGGGGTTCGTACAGGTGCCGTTCTCGAGGTTTCGCATGTCACCAGCCAGTACGACCCAGTCCGAGCCTGTTGATGAATGGTTTCGCGTGGAACCGA
CAAAGAAAACTGGCTCGTTCGCACCTCGACGCAAGGGCTCCcaagagaaagaggagatTGTTATGGACTGGGGAGAGCTGTGTGTTCGGATGAGCATATC
GGGACCTAATCTTCGTGATTTTTTCCGCAGCTCGGGGTTTGAATTTGTGCCGACGAGTCCTGTTGCCACAGCGAGCACTGAGCACACTGACAACCGCTTG
GAGGTCACTGTTATAGAGGCGAGGAATCTGATTAGTGCTGATACCAACGACTTGTCGGATCCTTATTGTGAACTCACTTTGCTGGATGATCATGGGAGGC
CAATTCCTGGCGAATACGCCACAACTGCCAAGCTGCACTGTACGCGTAACCCGGCGTGGGATAACGAGCACCATGTCTTTGGGTTGATCTGTCGTATTGA
GACGGCAGCCAGCCTCAAAGTGAGGATCATCGATTACGACAGGTCAGACCAACATGACCCGCTTGGTTACGTTCTCATCGACCTGGATCAGCTGTCCGCC
CACAAATGGACTGAGTGGCACACGCTGTTGCCTGAAGAAGGCATGGCGACCAGCGAAAGCCTCGGCGAGATTCAACTTCAAATCTGGCTGATTGGCGAGA
GACGCGGGGAACATGTTCGTGGGCAGAAAATTGACAAAGAGCTTAACCTGAAAGCACACAACGAGTCAATTGAGCAGCGCGATTACGAGAATGCCCAGTT
TGAGCTGCATGACGCGGCTTGCAAGCTGGATGGAGCACGTATACCATGTTCAGTGACCGACTACCAGGCGCGCGACCCGCGATTTTACGGCATCAACGGA
TGTATTCATTACCTGAATACGCAAATTCCGCGGGCCCATCAGGAGAAAATATCAACTGATGAAGGCTTtcaagcacgagctggtcTAGAAGGACAAGCAC
TGCTCGAGGTAACAGTTATCCAGGCATCTGAACTGAAGCAAAGTCAAAAGCACGTTGGCAACACAGGTACCACAGCTACTCCGTATGCAGTTATCGAGAT
CGATCCTACAGTATGTGTCGAGGAATGTAAGCGCACAAGTGCGCCAATGTTAGCTCAGCAAAGCAaacgaactgcagcagctggaagcGAGGCACGGAAC
ACCATGTTTTCAAAATCAGCCTCCGCAGACGTATCCTTGCATCGAAAGCAATTGACCAAGAACGAAGCACGATCGAAAAAGTCGCTGGAGAGTGACCTCG
ACATTCCAGTTTTAAAGGTGGAAATCTTGACAGGACATGGGCTCAATCCGGCCGATATGAACGGCTATAGTGACCCCTATTGCACACTTTCTATCACTGA
TCGCACAACAGGAAAGGAGATTGAGGCTGAAAAAAAGCGCACTGCAGTGATTTCTAAGACTTTGAATCCTGTGTGGGCCAACGAGAACTTCGTGTTCGGG
AATGTACGTTCTGTACTGTCATCCATAATGccatacttcgaagtacataCTAACCTGTTATTATTGTTATATTCGCAGAATGTCCCTCTTTCTGAGGCCA
GCTCGCTGTTAATTCACGTCAAAGATCACAATAACATTGGAAAGAGTACCCCTCTTGGCCGAGTGGAGATCTTACTATACGATTTATGCCGGGCATCGGC
GGATGGTACTACGATTAGTTCAAGACAAGTGGAAAAACGATATGAATTGAAACCTGAGCCCTGGATGAAAAAGCACGCCAAGGAGTTGGGAGAACTCTGC
ATTAAAACAGAGGTTGTAGGGAATGCAaatgcgctggaagagctgatGCTGCGTCTGTCAAATGGTAGTTTTTCTGGGGCCAACATTCAAAGGGGGCCCT
CCATGAACGTGATGAACATGTCTACGATAGAAGACTTGGATGAAACtgagtttgaagaagaaacgacTGAGGTTCTTCAGCGTGGGACCGCAATAAGGAC
GTCCACATCAAGAGTGCTCGGCGCCAGTGACAATGCAGCAACGTGGGGAAAGGAAAAGTTTTCGCTCTCGTTGTCATACCCAGGGATATTTAGTGATGTG
AAATATCCGAGCAGTGAAACTCAACTCCTTCAACTGCGTATCCACCAAGCTCGAAATCTGTTGGTCTCTGGTGACCGGATCAATCTTGGGTCTGACCTCG
ATCTTACTGTGGGGGACCCAGCTCCAACGCGGAAACACCATCGACTACAAAATGGAGCTAGCGTATACTTCACGGTCATCCCAGTTCGCCGTGACGGAAC
ACTAGAAGACGCCGAGCGAGTTCAGAGCCTAACTGTCTACAATGCTCGAGACCCATCATGGCCAGCCCAGAACTTTGTTTTCGGGAAAATCAAGGACATC
TCAAACGTGTCGTATTTGTCTCTTCATTTGTATGAGCGTGACTTGGAAAATGACCTGGAGACGGTTTTAGCCAAGCTCCTAACGGATAAAGAAAAGAAAT
TGGAGGTGTGTTTGAAGCGATCTCTGTTGCACAAACTTTCACCGGCTGGTGAAGTGGAGGATGACGATTTCGAGGTGTTACAGTTCGGACAACGCGTATT
GGCTTTTcgcggaggagaagatggaggacgcTTTTATCGTGCACGAATTGAGAGATATTTCCCATATCCAAAGGACGAATATGAAGTCCGTTTTAACGAT
GAAATTGAGACGATCGATGATTTCCGGAATCTGATTTCTCTGGATGTGAAAGGAATCGTtcaagcagaacgaggtGATGGCCAATTGGAAGTGATGATTG
AGAATGCCGTATCCACAAACGCAAACCTCGCTAAACGCAGCTCACGGTATGCTGTGGAGCCTACCCAGCTCGTCCCTGTAAACGGCTTGACCAAACATAT
CGAAAGATTAATGGCTAGACGTTTGGATATCGTGAACGAGGAGACCATGCGACGGGCAAGGTTGCAGCACCATGTTACAGGCATAGTTATCGAGGTTTTT
TCAGCATCGGATTTGCAGGTACTGTTGACAGAAGAGGGAAAACCTCCGATGTTGAAACAGCTCGACAAAGACAGTCATCCGTCATGTCGGGTAACGCTTC
TTGGAAAACCTATGCAAAACGAACCGAGTATTTGCTACTGTAATGACCAGGGCGAGTTATTTACCAGAGAAGCCATGCCGAAGTCGACATGGAAATGGGG
GACAAATAAGCCACTTGAAGCTATCATTACTTCCCAGGTCGATGCTACAGCTGATATTGATGCCCCTGGACCGAagagagcagcagatcctgcaCCTTCA
GACAACAAGTCAGTGGACCGCAAAGtgacaactgcagcttctcagCGAGAAAGAGCAAGCCATACCTGGATGTTCCAAAAGGAATCGTTGGTTATTGGCA
GAGTATCTGAATACGACTACGAGGCTATTGATCCAGATGAAGCCAAGGTCGGATACCAGATTCTTGGGCAAACATCAAGCATCTTTATTCAAATTGATGC
CAAAATTAAGAAGGAGAAAGCCAAGACTGATGACAAGACCGAGATATCAGGCAAGAAAAAGTCAAAGAAGAACGATatccaagttgaagatgCAGAATAT
CTGGAGGAAACGATTGGATATGTGAAAGTTGATCTCGCTTCGCTGCGGACTGGGCAGCAATACAAGTATCTACAGATCATCCCTCCCAGCTCGTCAAAGC
TCCCATTCTACAAGTCTGCAGGTACTCTTTTCGTCCGCTTTACGACAATTTCTGACGGCCAAACGTTGAACATTGGTGAATCGTCTGCTAAGccagaaga
acttgagcagcCTCCTTTGTTCAATTTAAGCGCATGGTTCCAGAAACAATGTCAGATCGAGGCGCAGTCGTCTACACTCTACACTCGGGGAGTGACGTGG
ATTGAGCGGCGACAAATTCTCAGATCGTCACTATCTCCAACTCAGAATGCTCAGATTGATGCATTGCATACAGTCCTCGTAATCATTATGAAACGGATTG
TAAGCATCCTTCGGGAAATACGACAATTTGAGGAGTTCGAAAGGCTTTCGCGGGACGAAATGATGGAGTGTCGTCTCGTTCACACCGTGAATGCTGTCCC
GGGTAGCCAATACCTAGGTCGAGCAATGGACACGTTGTCCCATGAAGTACGGAGGGAAATTGTCGTCGGGTTAGAGAATGAACTATTGGATTTGGCAGGA
GTGCCTGGGCCGCGCGTTTTCCCTGCTGATGATATGGGTCGTGAAGAATGGGTGCGCTTTCGTACTATCAggcagaagcttcttcaagaGAACGGCAGCT
TTTTCATGCGAGACCAAACAAGTGTACTGATTCTATTAGTCCCGAGAAGTTTCACTGGTGAAGGGATCATCTCTTGGTTCCGACGCCAGCCTGCCGTTTT
GTGGGATGACAAGTGGGATGCTTACTGCAACGACGATGCGATTTTATCCTCGTGCAAGTTGGGCTGGCGCAACCAGGACTTAGACTTTGATCGCGATGCG
CTTCAAGCACCAACCAGTGATTCTCACGCGTTGCAGTGGATGAGTGCTTTGTGTGCTGCTGGGTTTGTGGAAAATGTCACTCCAGGAATTACTGCTTTGG
ATGACTTTGGTCAGCGTCATGTGCTAATGGAAAACAGAGATGACCGGTTCTATCGCTTACGTGAAGTCGATATGTGGATGGAAAAACAATCACGTGACCA
GAGCTTGTTCCCTCTGGACATCGTTCGTGAGATTGATTGCTACCGTAAGAAGACCACCAACAATTCGAACAAGCAAACACTGCAGTTAAACgccagaaga
ggaagcgcgtACGCGAAGGAGCTGACAGAGCACTGTGACGGCTTTCTAGGCATGCATACTATGCTCTCCAGGATTGTGTTTACTGTCAAAGGCTGGAAAG
ACTCTCTCATATCCCCCACCAAAGCAAAGTCCGTTGGTGTCGCAGCTGCTGAAAAATCTGTGAAAAAGAATGGTGAAAATCCTGTGGAGGACCAAGGACG
CGCAGACCTTGCTGAGAACATTTTGTGGAATTGGAGATACTGCCTCTTAGATCCAGCTCGCAAACGTTTGTATGTGTATGAGAAAGAAACTTCAATGGCG
CCTATGGCTTTTATCGACATGGCAAATGCAGTTTGTAAAGTTGCCTACAACTTCTCGAATGACTCGGAAGGTGGCTGGATGGATATAATAAATCCTATGG
TGTGTGTGAGAAAAACAGACTCTAATGACTTCGAACTGGTGACCCCTGAAACTCTTGACAAGATGACAAAGACCCAGAAAGGCGGAGAGAAAGTTATTGA
GGTGAAAACACCAAATGCTCCAAAGTGGATTCAGGCCCTAGCGCGTTCAGGCGTTCGTGTCGATATGGGTCCAGGCCAGGAAGTATTGATGAAACAGCTT
AACCCATTTATTCTACAGCAAAAGTGCAACAAGTATGCCACGGAGTTCGACCCTAACGATCTCGAGGGAAGTTTTCATCGGCTGCTCAATCGGTTATTCG
GTCATGACAGGGGCCTAACGCACCACGACCACGAGAAAGAACGTCGAGAACTGCGGGCTCAAGTACGCAGTGAATTGAAGAAGGCAGGTGCTGAAGGTGA
GGCAGTCATGGCATATTATGGCAAAGGAAAGAACCTAAAAACCAAGCTTGGGCCCAGTGTGAACTTCAAGAAAGACTCGCTATACTCTGGACGAATTGTT
CGTATCCGGACGCCGTTTACCGAAGAAAAGTACCCGTTTAAGGCAACGTACGACCTGAACAACGCAACTGAGATTCCGAGAGACCTCAAGCAGCTTTTGG
AGAGGTACAAGGTGGATAGTAAGGCGTCGTGGTTGGGTTTGCCGAAGTCGCAGCGTGACATTTTCTTGCTGTACGATGTGGAGTACACTCTAGGTGACGA
ACGGATTGTCGAGGAAGGCCTCATGAGAGAGCATATTCGGACAAACGAAGGCGATCTCGATCCACAAAAAGTTCGCGACAAATGCGCTGACCTCAACATT
CTGTTCAAGGCCACCGACCTGGAAAACTGCGTTTCGCGAATGGTGAAGCACAGATACCGCCACAAGCCGCTTGGTGTACTGAAGATTCATACGAAGATGA
TCTCCCCGTATCGCACGCTCGATGCATGGCATCCTCTTGCTCCCGCAAGTGACATGCTCCAGAAGACAAATATTGGACAGCTAAGGGTGGAGCTTAAGAT
TGTTCAAAACCGAGAAGTGAAACGGAGTACTAAGTTCACCCCGATTTCTGAAgccatcgagaaggagacagCGGCGCCCCAGTTGCAAGAAAGCAAGGCG
CATAGCAAAGGCGCAACGAAACAGCTTTCGTTTGCCATGAGAAAAGAGCCATCCTTTGTTAAAATCGCGATACTGGAGGGACGTGGGCTACCTGTAGCCA
CTTGCGATCCATTTGTGGAGATTATTTTGTTAGATGGCAGCTCGAAGGAAATCGATACGAGTCTGAAAACGGACATAAAATCGAGCCCACTTAAGGGAAA
TGAGGAGTTTCTTTTGGGAAAAGTGGAGAAAACTAAGCTCAGTGATAAGAAGGCAATGCTGTTGCGCGTGATGAACTATGGGAAGACCTCGGCGAATGAC
CCGCTAGGCTGCGTCACGATTGAATTCCAACGAAGTGAGCTGGGGTACATAAAGGGGGTAATATTGACGCAAGCCGACGCTAATGGAAACGCTACTACGC
AAGAGCTGAAGATGAATAGCAAAaatcaagttgaagtggaggcAATGCTCCTTCCAGTAGTGTCTGGTAAGTCGAAACCCAAAAAGACGCCTGCACCGAA
CGGGGTGCTTGGGAAGTTGCGGTTTGTACTCGAGATCTTGCGCAATGAGAATTACGTGAACCACAACGCAAAACAGCAGCGTGGAACAGTCCATTCGGCA
GAGATAGCTATCAAGAGTGCATTTAAGACTGTCGGGCCTGCAGAAGATTGGAGTACTTACACATGTTACATTCAACCTCGTGGCGAAGACGGGCTGAACG
TGAAGTATGATCCTGCCTCGGAAGACCTCGGAATCAAGAATTCGTACAAATTCAGTGAGCTTCTTAGTTCAGCCTCGGAGCTAATGAGAGCTGAAAAGAT
GGGGAGGCTATCGCAAGGTACATCCTCTGAAAAGGGAGGGGTGTTTAAAGTCCTTGGTCGTACGTACGATTTGTCAATAGTGGATTACTTCGATGTCTGC
TTGGTTTCCGAGTCAACGGGAAAGTCTTACGAAGGACAACTTGGCAAGGGTGACTGTAAATCAGAGTGTAGAACCGATGACAAAGCGGAGAGAAAACCAA
AACTTTCACTGAAGACCCCGATGCAGTGTGCAAGTTTTCGAGATGAAACAATTATCCTGACTACCCGCGACTCCAAGGATACGGTGACTTTAACTTTCGA
CCTCAACTTAGTTGGAATTCGCCGAGCAGACCGTGTCAAAAGCCTGCTGACTGATACTTTCCGTTTGGTTGGACTGTCATTTGATTCTCGAACATTTAAC
CACAGCAGCGGTCGGTACAACCCAGAGCAACTGCGTAAGGACGTGGACGCTTTTCTGTGGGAAAATTGCCAATCGAATTTCTCGGGTCGTAATGTTACAG
AGGAGCTACTGACTCAATTGCGCACAATGAGCCAAGCTTCTAAGCTTCACTGGGAAATTACACCCAAACTGCTGGGTTACGTGTTTGAACTCGTGCTTTT
AAGTGGAGACAATGACCGGCTTTCGTATGCCGATACGGTTGCGCTGGACGCTATCCTCAATCGCTGGTCACGCATATTAACGCGAGTGGCTGAGGCTAAA
GATTATTTGACTGGCCATTTTCACGGGAAGAAGACACCACGACTGATTGAAAATCTGTTCACAGAGTGTGAGTGGATTGGGTTCAACTTCtcgcttctcg
ttggcgaGTCCAGCAGTGATAATAGCAGCGTCAGTCCGTCGAGTACAACCCCCAGTGCCCGAGAACGCTCGAGTTCTTTCTTTATGGACGATCGAGTTAC
TGTCAAAGTACCCTTCTTTAGGCGTGTTGGAGTAGCTGTGGATGTTCAGTTACTGGATGGGGGTTTTGCTGGCGGAAGAATAGTCAAGGAATGCAGTGGC
GGTCGATTCAACGTCAAACTCCGCCCAATTGCAGAGGAGACTAGCACTTCCAGTGGAGAAAAGCAATTGCCAAGAGTACTTCTAGAACGTCTTGCAATAC
TGAAAGAACATGACAGCGTCAACCACCCTGAATCCCCGTATTTGGTTGGATACGTAGACAACCTAGAGCCGTGTCAAGAATGGAAAACGCAAAGAGGGAT
AAGTACAATGCTCTTGCAGGTGGAGGGAGCGATGTTGAAGGCCCAGCTGGAAACGGACGACTACGTCCAGATTAGTGAAGCTTTTGTGGCTTCAAAAGAT
TCGACAAAGCGTCTCTCGATCTTGGATGGCTCTCAACCGGACAATAACAAGGCCAATAGCTCTTTCATTAGCAGTGGGAGAATGCGTCCTGGGAAGATCA
CACGATGCTATGGCGATGCACGGTACGACATTGTATATACCGATGGACAACTGCCTCCTGATGAAAGCGCGGTGAACAGGCTGCGTTTGGTATCAGTGTT
CTCTGAAGCGATGTATGATGGAAAAGTAGCAGCCATGTatcctgctgcagcagatccgagGGTCGGACCTCCCGAGATTAAGTACAGTGTTTGCCTTGAG
AACGGCGAGATGATCGAGAATTTGGCACGGGACCAGATCCGAGCGCGTCAAGGATACTCAGCGACTGACACGACATTGCTTGGAGCCATTTTCAGCTCGA
GCCTGCCGGTATTTGGTAAGAGGATGGATCGAGCGTCGGACTCGGTTTCAAACATGGCTACAACGTTGAGCAGGCTTTGGTGGGGCAGCGACAAGATCGT
AAAGGTATATGCGATTCTTCCAGCTGCTGTGAAATCTGTTACAGTCCGCAATcccaccacgaagaagctgatggaaacagcgcttctggagctgAACAAA
GATCACTCACGTTTCCTCGGTCAATATCATGGATTTGTTAAGGGGGAGACTTTGGATGACaccgaggagaagcagctcaagatgatACACGCTGCTGTCT
CGAAATGTCGTAAGCACAGCGGATCCACACACGCGATGGTGCCTTTCACTAAGGAGAACTGTTTCTACTTGCTAGTATCCCCGCCTCCGCTTGTTAACGT
TCGCGGACGTCTCCATGTATGTTCGTCATCTCAATCTGCAGCGCTGTTCAAGGGGTTGGTTCTGGCTACTATAACAAAGGCCCCGGGCTCAATCGTGCCA
CTCGTTCAACAACTGCTGCGTGCGGAGTACAATACGAACCTGAAATCCTGCGCGAAAACGTGTCGAGTGACCATTGAACGATTGGAAGTTGAATTTGCCA
AGAAACACGCTTGCAACGTGGTATTTAATCCGTCGCGACCAAGTTCCAAGGACATGCTCCCAGTTGCCAGTACACTCCTCAAAGACCTTGCTGGGGTATC
GTGGATGGATGCAAGTATTGATATTGTGTTCGAGCTGTCCGTTCCTTATAACGACCAGGGTAATATCATCGAAGCAACAGCCAGTGCCTACGAACATGCA
GCAACCATTTCGAAGCGACTCCAAACCATAAACACGCTCGCTGTAGAAGGTGACATGCTGTTATTGGACCCTCGTGCTGTGGATAAACTGTCTTGGGTTA
TGGCGCCTTTCGAGAGCACACTCAATCCTAGAAGGACGTTATCGATTGGTTTTCGTAGCCATACCGGCAGACTCGACCTGAAACCAGACGTTTCGCTTGC
GCCAATGGAAGATATTCGTGTGAGAGTTTGCGATTTCGAGAACAATAGTCACGATCTCCACTTCCGAATTGGTGACATTTTGGCGGAAGCTAAAGTTCGA
AGCAAACTTGCTCCATTCCACAAAGCCGTAGTCGTTTCCCCACCGTCGGACTTAAATGAGCGATGTAGCGTGCAATTTGCATCAGGAATGAGAAAAGCCG
AtgaggtgctggtggacaagaCAACTGCTGCACAACCGAAGTCAAACTTGAACGCCAGCGTGGAGGTACCGACTGGAAACATTAAATTCGACAAGCTCTA
CGTGAAAGTGTTCGAAGCAAGTAACATGTCATTTAAAGACAAGACGCTAGGTGAGGATCTGCAGGTGGAAGTCGTACTCATCTCCAGTGATTTCAAGAAG
CACATGACTACCACCaaagacaagaagatcaccaCTCCTTTCGGCGTGGAGGTTTCTTCGGTAGGCGAAATCTTACCGAATATGTACCCCAAAACGTCGA
CCTTTTTGCTAGCGTACGAAAGTGCAATTGCACAGGAGACGAAGCTTCCATCAGTGGCGTGGAAGGCTAGTAAGAAGGGGCTCTCACATGTTGAGTTTAA
GTACCCGGACATTGACATTGATCGTGTCTCCGAAGTGATTCTAACTGTTCGagacaagaagaccaagatcgGAACTGTCACAGTCCCAGTGGAGGAAATC
GCTGTTTCCCAGTCAGTCAATAGTACCAACAAGCGGAAAGATGAGCCCATCTATCACCTGCAGTTAGACGGGTCTGATTCGAAACGTGTTGTAGTTGGAA
CGCTTTCGTTGTGCATTGAGCGAATCCAAAAGTacggtgctggtgctgaggTGTatgccaagcagctcgagaaaTCCGTGGACTTCTGGGCCATCTCTCC
GACTGAACTTCTCAAAATGACTCTAGAGCAGAATGAAAACAAGTTGTCGCGTAGCTTCTTGGCTATGGATCCTCCAGTCCTGGGTGAAGGTAAGGTGTTG
CTGAAAGAACCAGATGACATGGAACTTCAGCTACAAAAGATCACTAAGGTCCAGATGTTCGACGCTGCGACAAAGGCTCAGTCGTCTCACTCCGTGTCCG
TGGTGTCTTCCACCTTGAAAGCTGCCAAACTGTCTGGCTTGGATTTGAAGACTCGAGCGCTCGACCAGTTACAACTCACACTGGAAAATACGAAGTTAAT
TGTGAAAGATGCCGCTACGGAGTTGGGACTTGGCCAGTACGTGATAGACCAGAGGCTTCCGTGGTCGTTCGATCCTCATGCTGACAAGAATGAGAGCCAA
CACCGTGATGATGTGGTGATAGTAGAAGCAAACGTGACCACCTGTACGCTTCGAATGCAGCGCACAGTACTAAAGCTGCATGAAGTGCTAGCCACACATT
TTATTCCGAGGCTAGATGAGCTCTACAATTTGGATGCCAAAggtgacgacgtcgacatcGTTAAAGGCGAAAAACTGCTGTCATTTTTTGATactgaagt
ggaagaactggagccGGAGGACCAGAAGGTCCGTCTTCGACTGTATCAGCGACTTCGCCTCACAAAACTCATCCAAGTACTTGACATGATTATGAGAGCC
TCGGTGCGCGTGAATGTTATGGATGAAGGTCGCAACAACGTTGATGGCTATCTGGGCACCGCTTGCATCCCGTTGAtggatcttcttgaccaACAACCTC
GTGATGACGTctacgagctgctgtactTACCCCCTACGAACTTGAGCGGCGCTCGGAATGCTGTTCAAGTTCAGGGGCAAAAAGGTAGAGGGAAACTACG
tttgcgtctccatctgAAAGTGTCGGAAAGCTCGTTCTTCGAAGAAGCGATCAGTGTGTACAAGAACTGGAAAGAACGGTACATTGCACAGCACGAAGCG
GCTCGGAGGCGCATCCACGATACAGTTGTGCCTGcgcagcgacgacgatggatGACCATCAAGCTCTATTTGGATGAGCTCATGATGCAGGCCGATGGCA
AGCTACACTGGGAGCGTACGCCAGTGCTGCTTAACCTCGTCTGGGACATCTTTGCTTTGCACGAAACCTCCCCCACccacagcaagaagaagccgactAA
CGCTGATGAGGCGGAATACGCCCAGAAACTCGACGGAATGGCAAGTGATTATCGGGGAGCGGTGATGAAAGTACACAAGCGGTGGGTTAATCTACAGCcg
gaactggacgagatcttGACGATTCAGGCTGCCTCAAAGATTGATGCCACGCGCACACCACAGGTACTTGACGATATCGAGAAAGAAATTGAAGGCTTGG
ACGTGGGCCTGAGTACAGCGTGGAAACAGGTGAAACAAAAGTGGCTGAAGTTACTGGATGTTTTGGAGGAACTGGTGGGAATGCAGGAGCGCAAGCTGAG
CCTGACTCGAGCCCCTCAATTACTGGATATCGTGAAACAGAGTTGTAGTAAAGGACTTAACCCCCGCCACTCAAAAGCAGTATCGCAGACTCAGGCTCGT
TGGATTGCGATCACGCAGGAGAACGGACCGCTAAGCGAGCTCCGgttgatggagaagacagGTCTGCACTGGCGACGCACTCATGAACTATTGTTGCTTC
TCGATGAACAGTGCGAAGACTTTGCGCCTgttgatgctgcagctctcgaatCTGTACAAAATCGATGGGAACAAGTCCAAGAGTGGCTCAACGAGGTTGT
CGAAATGCAGTTGCAGTACTCTATTGACTGCGAGCACACGCCCGTGATCCTGGAAAAGATGCACTTGTGGAAACCTTCACGCCTTAGACGACACGAAGAG
TTGACTAAGCGTGAGAGATCGTCGAGTCTTAGTGGGGTTCCTTTATCTTCTCCAAAAGGTacagatgctgctgctcgtagaCAGCATGGGCTACCCGGGC
AGCACTCCGTGTCATCTGAAGGAAGCTTCAGGCCTGAAAATGGTGCTGATGACATCGATCAATTGGAAGGCATGGAAGAATGGTATGCCATCGAGGAAGC
AAAGTACGAACTTGAACGAATTCCTTACCATCGCATAACGGGAgatgacgagaagaagaattgGCTGCTGTATTCACGTGATGGACAGGATACACGCCTA
ACAATTACCCAGGAAGAGATGGTCTTCACACCTGCTAATGTTCGTCTCGCACTGGAAGATCGTGGCGTAATTCCAAAGACCTCACTGTTTGATCCGACCG
GTGACGTGCATTATAATGCAAACGCAAATGATGAAGCTTGGGTTCAGCCGTCACTACTGGATTCGAAGTCTGGGTCCCAGTCTGTTGTGCTGCCAAAGCA
CATCGACGAAGAAATTCAACAGTTCGAGGAAATCCTCGAATCGCATCGTGATAGCAAACAACAATTCTTCTCGTTAGCGAACCCGGAACGAGTAGCAGAG
CTCTACCAAGCGATGGAGAGTCTCGGAAAGACCGACTTGCTCTGGATTGTCAATAATGCTGTGAGTGTGAATCGCGAGTTGGTAGTTCCGGAGAACTACC
AGGTGCTGCTGCGGGAGATGACAATACGACACATCCGAACGACGGAAGTCGAGGACCTGGTGAAATCTCTCGAAATCGCGTTACAAAGTGACGAATTGGC
TGCCAAAGGCATCACAGTTACCGACACTGCTAACCCTACAGCATTGCTACAGCTAATGACCCGTTACCAGATCAAGGAAGTCGCTGTTCCACAGGACATT
CACACTATCCAGACTCTACTTGTCGATCGAGGGATGGACACCAAGGGCGAGCCTGTGATGCTTCGTGGGGTCCGCATTGGTACCCAAGCCACAACCCAGA
CTTCCAATGCAGCACCTCTCTCTAAGACTCTAAACACGGGACTAGGTATCATCGACACACAAATCGAGGCTCTACGTGAAACCTTGCTGTTTGAAGCACT
GCGCAAGCGAAACTCGCTGGTGCACACGTTCGCCATTAAATCCCATGTTCTCGATGAGGAGAACAAGAGGTCTGAAGCCGACgtgttcgctgctgcagtg
gaaaATGCCGAGGTTGCCCTAAATGGTGACTATCTGACTCTTGTCGAGCGATTCCAGCGGCTCCTAGTGCACGAGTCATACACGAAACGACTAGCAGCGT
ACGCAGCACAGGACCGATGCATGAGAGCTCTACTGGGCAAGTCTCGAGATGAAGTTGTGACGAAAGAGGACATCGCCATGGAGCTTCATAACGTCAATAA
GCGAGTTGTCGGTGCGAACTACCGACTTCCACCTGAGGCATTTACgacggaagagcttcagcaagCTGTAGCCGTTGGGCGCATTCGTACGCCAAGTGAA
GCAATGCTGTTACGTTGTCCGAAGGGGAAAAACGCTAGTGCCATGGCACATTACGCGGCCATCAGCTACGCTGCTAACGTCTTCCAGGAGGTCACGAGCT
TCCGCTCACGAGTTGATCGGGTAACGAATCAGCTGCAAGATACTTTCTGGTATGACGAGAGCAGTGGTCTGGATGGTGTGTTTATTCCAATGCAACGACA
GCGGCGGACATTCAGTCAGTCGATTGCAGACTGGCTGCTGGGATTTGACGCGTCGAAGTTAAGCATTAAACGCAAGCTAACCACTGCTCATCGCCAAAGA
CTGGAGTGggcatctgcagctttcacaCTGCGCAATCGGTGGCTGCAGCGGGGACTTGGGTGGTGCGACCACGAATTTGGAGAAGGTGTTGGAGTGAAGA
TTctgcttgatcgtcttctccttttcgAAGCTGCTAACAAGATGGACAtggtgaagacggagaagctgttgagGGAGGTTCGGGACAAGTGTTCCAAGTT
GCGTGCTCGTGAGCAAGAGGCGCAAGCGAAACTCGAAGGGCGGTACCAAGAGAACCTCGACTTactcgagaagctcgtgactCATGCGGAACGATGCATG
AATAACCGGAAACTGCATTCAGAAGAGACGCCAGTGCTTTTGCACAAGCTCGAGCAGGTATGTGTGGTCCCCAAGGGACTAAACGATCGCCACCGGGAAG
CTTATCACACGGTTGCAACGCACTGGCTGCCacatcagcagcacctcACGGAGCTTGTCAAGATGCACCGAGAGGGAACATTCAGCATCACCCGTACGCC
AGAACTGCTAGGGATGATGCAGTATCACACGGAGGGTAAGGCAGGCGCCGAGGAGTTGAATGAGGAAAAGGTCACAGCTTCTGCCCAGCGAGTTGCGCCT
GAGCTCCAGGCTACTTTTGTGGATCGGAAGTTGAATGAAGTGCGGCTTGGGCAGCGCAAGGAACCATCCATGCTGCACTTGGatctggacgtggaggaTA
CCGTGAATCAAACCGCGGATGACACAGAGTGGAAAGAGTTGTCGCATTCGAAGAGAGAGGCTAAGCCACTGTCTCCGCACGAGAAACACACAAAGTGgaa
cgtggtgaagaacgcagtcgcagcaaacgcagcgttttcagcggcgtctccgaGTAAATCCAAGGCGGAGACGGTGAAAATCGAGCCAAAAGCGCTACCT
TTATCTCCTCGTCGAAAGCTGTCGCTAAGtgacgagctgaaggagttGCTGAGATCTCCAAGCCAGTGGTTGGCCAGCTCAGGCGCGCAAGAGATCTCCA
TCGCACCCGAAGTTTATTTCCCGAAGGAGTTGGTGTTGGAAACTACCAGCGAGTCGAAGCATTCGACTAAGTAA