Transcript Name :
Phymu_g21
Orientation:
(+)
Number of Exons:
10
Description :
hypothetical protein PHYSODRAFT_532657
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-6
25-550
7-24
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K09680
*** None ***
Sequence
        2585 bases(100 bases per row)
ATGACGGCGGACAGCGCGCTGCTGGCCGGTGGtttcctgctcttctcctcgacagTGGCGCTCTTCTGCCTAGAGCGTAAACGCCACCGTCAGCGCGTCT
GGCGCCAGCGTCTCACCTacaagaagctctcgaaatCGTGCGCTTGGATTTTCCCCctcttgttgctgcggaCGCTTTCTAACCGTCAATCCTACTCCTA
CAGATCCGACCTGGGCGCGTCCTTCGGCTTGGATATTGGTGCGGACGAAAATCCATCGGTACCGTTTTCTGATTTAACGTTGAACTGACGCTGCGTGTGG
CTGTAGGCGGCACATTGGCCAAGATCGTGTACTTTGAGCGCTATGAGGCTGGCAACGACACGCGCAAGCGGCCGCGCTCAGCGTCGCTGGATGTGGCGGC
TGGAGAGATGAACACGTTCTTGCGCGAGAATCACTCGTTCGGCAGTACGGGCGTGCAAGACGTGCGGCTGCGGATCCACGCCAAGTCTTTGAACGGGGTG
AACCGCTTTTGGTACTGTTTTGTGTCATGACTGCACTTTGGACTAATCGAAGGTTTGTGgtgtctacatgtagatctTCCACTTTGTGCGGTTCGAGAGC
AACAAAACACGAGACGCTATTGAGTTTATTGCCATCAACGGGATCAATCAGTCGCTCAGGATCTTGCCCTGCACGGGAGGAGGAGCGCACAAGGTTTGTC
GTGTGGGGAATTGATACTGCAGACTCGCGCTGACAGGAGGGTGTTGCTTGGTTTGCAGTATGGACGTGCATTTACTGAAATCGCTGGAattgagctggag
aagtacgacgagatcgactgCACCATTCTGGGACTGCATCTGTTGCTCACGACGCTATCCGATGAAGTGTACACTTTTGAGGTAAGCGAGTGCATGATGC
ATTGGCCTGTTGTATCGGCTATGAAGTTTTGTTGGACTGAACGACTGCAATTTAGGTCGTCGATTTCAACTCGTTGGCAGCGTCGCGGGTTAAAACGATC
CAAACGGATACAGATGAGGGTATTTACCCGTATCTGGTGGGTCTTGCTGTGGTTAGATTTTAAATGTTGCTGTTGAGGTGACTAACTTTACGCATTGTGT
GTGTGGTTGCATAGCTTGTTAGTATTGGATCGGGTGTAAGTGTGCTCTACGTAAAGGGGCCGGGGGATTATGAGCGTGTGagtggcagcagcattgGCGG
GGGCACCTACTGGGGTCTCTGCCGTCTCATGACACACTGTGAATCCTACGACGAGGCATTGGACTTGTGTGTGCACGGATCCAACAAATCGGTCGATATG
AGTGTGGGTGATATCTATGGTGGAGCGTACGATAAGTTCAAGCTCCCCGCATCAGCCGTTGCCAGTAGCTTTGGCAAAATGATTTCTACTTCTCGCGAGA
GTGTGAGTGACGCGGATCTTGCTCGATCGCTTCTGGTCATGATCACGCAAAATATTGGCCAGGTTGCCTTCCTGAATGCGACTTTGTACAAGACCAAGAA
TATCTTCTTCGTTGGGAATTTTCTTCGGCACAACAAGATTTCGTCAAGGACGCTGGCGTATGCAATTAATTTCTGGTCGAACGGAGCGATGGAGGCGCGT
TTTTGTAAGCACGAAGGGTATTTAGGCGCACTAGGTGCGTTCTTACGCCACGCCGAGGCAACCAAAGCCCACGGGGAAGAATTTGTATCAGCCACACGAG
GCTCACGGCAGTCGTCCTAGATACGAGGCGAAATTGGAATGTGCACGAGTTTAATGGGAACCACGTCGAGCGAAAGTTTCTTTGAATTAGAAACACCATT
GATTGTAATTCATGTTGAAAAGCGGTCATCATTCAAATTGGAGATTTTGGTGAAGGATTAACGTTATCCCTATCAAGCTTGAATCAAAGGGCACCAAATG
CCGGCCGATTCGACAAAGTAGGAGCCATTGACATTGGGTCCACCGCCAGATTATGGCCACCTCACGACTGATTGCGCGCAGCTCCGACTAGTGCTGTTAC
GCAGCGCATAGACATCCTTCCTGATCAACTTCCAAAGATGCAGGGGCAAGCCGACCTTGCTCATGGACGTCTCTGCATTTTGTTGGTTGGCGTGGGCATT
GCAATGCAGGAGCCCGACATTTTTATTCTACAAGTTCATACCAAGTGACCAAGCACCTAATCCAAGTCACCATGCCGCTCACCATCCCTGGCTTCCACAC
CAACACCGCTAGACGCGACCTTCGATCGGTGGTTTGCACCTGATCTACAACTACGATGCCGAGTTGGCGGACGGCAAGCCCGAGAAGTGGCGGTACGAGC
TTTGGTTCTTCTCGCACGACCGCGTGGTGCACGCCATCCACGGCAGCCCGATGACCGGTCGTATAAACTACCAGGCGTGCACGTACCAGTGCATCCGCCT
AGGAGAGCTGTGTGGAGGAGACGGGCACTATCGTGAGTCTGGTGTTCGACAACAAGCAACAGAAGTTGGCGACCATGATCATCTCCAAGGGCCACTAGGG
ACACCCCGTAGAGGCCCATGGCGATAAGCGCAAGCTCGCCGACTACGGCAACCTGAAGGGCCGTCTGCTGCCGTGCGAGCACTGA