Transcript Name :
Phymu_g6
Orientation:
(-)
Number of Exons:
1
Description :
transient receptor potential Ca2 channel (TRP-CC) family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ankyrin repeat11.674PS50088
Ankyrin repeat-containing domain51.542PS50297
Ankyrin repeat12.129PS50088
Ankyrin repeat9.271PS50088
Ankyrin repeat14.265PS50088
Ankyrin repeat10.125PS50088
Ankyrin repeat9.244PS50088
Ankyrin repeat9.084PS50088
HmmSmart predictionP-Valprediction_id
Ankyrin repeat3900SM00248
Ankyrin repeat0.0098SM00248
Ankyrin repeat0.004SM00248
Ankyrin repeat1700SM00248
Ankyrin repeat89SM00248
Ankyrin repeat1.6SM00248
Ankyrin repeat0.012SM00248
Ankyrin repeat3.6SM00248
Ankyrin repeat58SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-36
86-142
60-62
166-1101
37-59
63-85
143-165
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3306 bases(100 bases per row)
ATGGCTACCGATGCCGCGGacgcgccgccgccttcgtctccgtcgcgaCTGCGGTGGCGGGGCGCCGACGCATGTCTGCAGTGGTCCAACTCGTACTACA
CGTGGCGGGTGGCGCTCAcctcgctgctctcgctcGGGTccctcctgctgctcttcttcaccagtTCCCAAGGTTTCGTGCTGGACATTTGGCTCGCCTT
GCAGGTGCTCAACGTATCGCTGGGGCTGGCAGCCCTCCCTTTCTTTCCCCTATATCGTGTGCGCGAAATTGCACCCCCAAATACCGAAGAGTccgccaca
gcagccactacaagcgagcagctcctgggcaCCAGGgccatgagctccttcacgcTCTCCCGCTCAGCTTTTGACGCGCCTGGCGTCACTCTGGAGCGAA
CATTGACACTGGCAGTATTTGAGGCCATTGTGGTAGTGCAGACGGTGTCGCTGTCGTGGATTGTGGTGCTGATGCTCGGCGTGTATTGGGCTTTCGGAGA
GCTCACGGAGCAAGGAGTGTGGAAAATTTGGCGTGACCCCGtgtcgtacgtgacgctgtTTGCGATCCTCACGATTGCTCTGCACACGCAGCAGTTCGAC
AAGCTTCGTGCACACCAACAGTTGCAGCTTGGGGCTGGtctggaggacgatgaaTTGATGGCGGTGGCTCCCACAGCTCTGGCTGGAGCAAATTCTGGCG
GATCGGAGGCTTCTGTGGACAAAAGCTCTGGTACAAGTGGTGTGCATACGCCGATCTTGCAGTCGAATCACGTGGACTCGTACTTGACGCTGAACCAGGA
GCTGCATCCGTGGGCGACGACAAAGGGTACAGTTCGAACGGTGGAGAGACAACTGCGAGGCGCACTTTACGATGCAGCTGCAAGTGGGAATTGCGCCGCG
GTGGAGAAACTACTGGAACGAGCAGAGCACGTGCTTGGGTCGAAGGTGCAGCTCGATATGCTGCTCAATCGCATGTACACGACGCCATCGCTTTTTTGCT
GGATGTTTTCGCACCGAACGCACAATCCCCTGCATGTGGCGtgtcgagctggagacttTCGCGTTGTAGCagtgttgctggaggcggGCTTGAACCCCAA
TTTCCTAGATAAAATCTCTGGCGCCAGtttcaacttggagctgctgtatGAACTGTGCCAGTTACGCGTGAAGAAAGTTACTCATATCCTGGGGTCACCC
CTGCATGTGGCTGCATTACACGGTCACACACAAGTTATCGATCTCTTGGTGCAGTACGGAGCCAATTTGGATATTTTGGCTCGATCGAGCTTTTTCTCGC
GCTCCATGCGCGTCACTCCAATCTTCCTCGCAGATTCGGCTGATGTTGTGGAGTGCCTGATACAGCACCGGGCGAATATTCTTTTAGTGCCAGGTGGCGG
CAATGCCGCTAGCACGACAGTGCTTCAACGTGCACAGCTCTCTGGTCGTCGTGAATTAGCCACGGTGCTAGAAGAATGGGGTGCTGATGTTGCGCTTACT
CCACTCcacgaggctgcagctgctggaaatctTGCAGCCGTGCACCATTTGCTGTCATGGGGTATCAGCGCTGACATTCTGGGCGAGTTTCAGCGCGGAG
CAAACAGTCGGACACCGCTACATTGGGCCGCCGTGATGGGAAGGCACCGAGTGATTAGTGAATTGGTTAAACGCGGTGCTGACGTCAATGCGAAGGACAG
TTATGGACGTACACCTCTGCACTGGGCAGCCCGTCATAACTATGCTGGAGCAGTagaagagcttcttgccgTGGATGCAGATTACCTGCAACTGGATTAT
GACGGACTTACACCATTGGCGTTTGCAGTTGATGGCGGACTGTTGCGGGGTGACTGTGTGGAGCTTTTTGTCCGCTTCGGGGCGGATGTTGATGCCATCG
TTCCCAATCAAGTAGAAGAAACCCCTCTGCACATCGCATTACGGCTTGGATATAAAGAAACTGCGCTAGCCTTGCTCGTTGAAGGTAAAGCCGATCTGTA
CGCTCTGAACGGGGAAGGCCGGCGTGCCGTTGAGTGCTGCGCATCGGCTGAACTGCAATACGCAGTGAAAGTTGCCGGTGGTTGTGTCGACGTTGTACTA
TCGTTCGACCCAGTGTTTCGTAAATTTGCAGAGCGTGTGCGTGCTGGCATTGAGCAGAATTTCATGACAGTGTACATGCGcagcgaagaggacgatACTG
TGGGAAGAGTGGGTGGTGGCGCGTCGGAAAAATCGCTGGAAGTGATGAAAAATGCCTCTGCAATCGTCTGCATGCTTAGCGACGGATACGCTCAAAGCGT
CTTGTGTATGGATGAACTCGCgttcgccaagcagcacgaggttCCAGTGGTTCCGATATCCTGCGAATCCGTGAAAATGTCGGAGGAATTGCAGgttttt
gttttcacccGGCAGATCGTCCCGTTTGGTCAGGCCGTGACGTCACATCACTTTAAGACAGCAGAATCCAGTGAAGACGGTTCTACAGTATCGGAAGGGT
CGACTGTAGACCACGTGGAGTTTGAAATTGATGAGGACAAGTTCCAGGCCAGCCTCAGAAGTCTCATTGATGGTTTACGGGATGAAGTGGAGATTCATCG
GCTTGAAGGTGATCGAGACCTGGCTCAAACAACACTAAGCAAGCATCAGCCATTGGGGAGGGCTGCGACACTGAGACGTCGACGGTTAGACGAGATTGTG
AACGCTGTTATCGTGCGTGGAAGCGGAAGGAGGAATACTTTTGGAGGAGGACCGACATTCTCTATCTTTGTTTCGCACGGGGACTGCCATCGTGACTTCG
TGACGCGTTTGTGCACCGAACTTCGGCGCCACCAGTTGCCTTTCGTGGTTGATTCAATGACCAATGTGTCTAGCACCAAGGAGCGGATTTTAGCGGCGAA
GGACGCTATATTGCAGAGTTCGGTGTTTCTTGTGGTGTTGTCAGAGCGCAGTGTGAAAACTGAGCTGGTCAGTGACCAGTTAGCGTTTGCTGAAGATAAA
GGCAAGACCATTGTGCCGATTTACTTCTCCAAACGGCCTCGAGGTGTGGATTCAACGTTGGGGAGGTTGTTTGAGCGAGAAGGTAGAGCATACATCTTTT
CTAGTGACATCAGTTACGGCCGTGGCTTTGGAGAATTACTGCACGAGTTGCGCTCGGGTGACGGGGATGAATTTCGTCccagtggagctggtgtgtCCTT
ATTGTCAAGTCCAGTGGCTCAGGCTGCAGCCCGCCGATTGTTGCAGAATTCGAGGCTTTTCAATGGATCAAGTCGTAAGCCTCCCCCTCGTGCAAGTGTT
GGCTGA